Gene/Protein Characteristic Table for KIAA1007
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04593
Accession No AB023224
Description CCR4-NOT transcription complex, subunit 1
Clone name bg00162
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (6518 bp)
Predicted protein sequence (1835 aa)
Source Human adult brain
Rouge ID mKIAA1007 by Kazusa Mouse cDNA Project
Note We replaced hk10102, former representative clones for KIAA1007 with bg00162. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 6518 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1009 bp
Genome contig ID gi51511732r_57011355
PolyA signal sequence
(ATTAAA,-20)		 
+----*----+----*----+----*----+----
ATACTGTAGCTAACCATTAAAGTCATGACACACAC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATGAGTCCACTGTGCCTTTCTCAGTAGCAGCAGCCAGTGCTGGTGGTGAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 r 57111355 57167964 36 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1835 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
ABQ66268 0 99.9 CNOT1 [Homo sap...
 Homo sapiens
A5YKK6 0 99.7 CCR4-NOT transc...
 Homo sapiens
XP_001102008 0 99.6 similar to CCR4...
 Macaca mulatta
CAH18093 0 99.6 hypothetical pr...
 Homo sapiens
XP_613555 0 99.5 CCR4-NOT transc...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007196 1455 1835 PF04054 CCR4-Not complex component
ScanRegExp IPR001220 1713 1719 PS00307 Legume lectin
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TATAAAGGGAAACCAGACCAG
Primer_r TTCAGTGGGGTAATGGGGGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f TATAAAGGGAAACCAGACCAG
Primer_r TTCAGTGGGGTAATGGGGGAG
PCR product length 142 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp