KIAA1148

Product ID	ORK05638
Accession No	AB032974
Description	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Clone name	bg00390
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7384 bp) Predicted protein sequence (543 aa)
Source	Human adult brain
Rouge ID	mKIAA1148 by Kazusa Mouse cDNA Project
Note	We replaced hg00436, former representative clones for KIAA1148 with bg00390. (2002/12/27) Please refer to "Gene/Protein Characteristic Table for KIAA1636" because the cDNA sequence of KIAA1148 is included in KIAA1636.

Length: 7384 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5750 bp
Genome contig ID	gi51511734f_58751415
PolyA signal sequence (TATAAA,-26)	+--------+--------+----*----+---- GTACTTATTTATAAATGGCTAACACTTGGAAAACC
Flanking genome sequence (107385 - 107434)	----+--------+--------+--------+--------+----* ATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGGGAGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	58851415	58858798	1	100.0	Perfect prediction

Length: 543 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB92314	1e-164	100.0	putative ankyri...	Homo sapiens
EAW94330	1.3e-164	100.0	hCG1810810, iso...	Homo sapiens
EAW94331	1.4e-164	100.0	hCG1810810, iso...	Homo sapiens
EAW94329	1.5e-164	100.0	hCG1810810, iso...	Homo sapiens
EAW94327	1.5e-164	100.0	hCG1810810, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046856	1.1e-86	100.0	KIAA1636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ATCTCCACTTCATTCACAGGT
Primer_r	CAAAGATGCTGTGCTAGATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-