Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00934 |
---|---|
Accession No | AB058762 |
Description | melanoma antigen family D4B, transcript variant 1 |
Clone name | bm01165 |
Vector information | |
cDNA sequence | DNA sequence (2576 bp) Predicted protein sequence (761 aa) |
HaloTag ORF Clone |
FHC00934
|
Flexi ORF Clone | FXC00934 |
Source | Human adult brain |
Note | We replaced fh15135, former representative clones for KIAA1859 with bm01165. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 200 bp |
---|---|
Genome contig ID | gi89161218f_51844683 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107421 - 107470) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | TCTTCGATTTCACTCAGCCGG |
---|---|
Primer_r | CTGCTGCCACAACATTCTGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |