Gene/Protein Characteristic Table for KIAA1859
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00934
Accession No AB058762
Description melanoma antigen family D4B, transcript variant 1
Clone name bm01165
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (2576 bp)
Predicted protein sequence (761 aa)
Flexi ORF Clone FXC00934
Source Human adult brain
Note We replaced fh15135, former representative clones for KIAA1859 with bm01165. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 2576 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 200 bp
Genome contig ID gi89161218f_51844683
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TTTGGGTATCAGTGTTACATTAAAGTTGCAAAATT
Flanking genome sequence
(107421 - 107470)
----+----*----+----*----+----*----+----*----+----*
AATTTGGATGTTTCTTCCTTTACCTGCACACCCATTGCTATACCTGGCCA
Features of the protein sequence
Description

Length: 761 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96JG8 0 100.0 Melanoma-associ...
Homo sapiens
BAF82147 0 99.9 unnamed protein...
Homo sapiens
XP_001085892 0 97.0 similar to mela...
Macaca mulatta
BAB33379 0 100.0 MAGE-E1b [Homo ...
Homo sapiens
XP_001497708 0 91.3 melanoma antige...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029037 1.6e-36 41.5 KIAA1114
AB046807 2.7e-15 26.2 KIAA1587
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002190 440 609 PF01454 MAGE protein
ProfileScan IPR002190 433 631 PS50838 MAGE protein
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCTTCGATTTCACTCAGCCGG
Primer_r CTGCTGCCACAACATTCTGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp