KIAA1455

Product ID	ORK05661
Accession No	AB040888
Description	teneurin transmembrane protein 3
Clone name	ef02451
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7698 bp) Predicted protein sequence (2450 aa)
Source
Rouge ID	mKIAA1455 by Kazusa Mouse cDNA Project
Note	We replaced fh16070, former representative clones for KIAA1455 with ef02451. (2005/08/06)

Length: 7698 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	328 bp
Genome contig ID	gi89161207f_183686796
PolyA signal sequence (None)	+--------+--------+----*----+---- TCTGTTCCTTCTAGGCACTGTATTTAACTAACTTT
Flanking genome sequence (272032 - 272081)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAAAAATGTGTACAGTGTTTCCAAATAGTCCCGAATTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	183762710	183958826	25	99.7	Perfect prediction

Length: 2450 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P273	100.0	Teneurin-3; Sho...	Homo sapiens
XP_001160536	99.8	similar to Ten-...	Pan troglodytes
XP_001091761	99.6	similar to odd ...	Macaca mulatta
XP_870167	98.9	similar to Tene...	Bos taurus
XP_001492464	98.9	similar to Tene...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032953	0	70.7	KIAA1127
AB037723	0	70.2	KIAA1302
D63483	1.2e-18	31.9	KIAA0149
AB058677	4.6e-17	29.8	KIAA1781
AB058676	5.6e-16	30.9	KIAA1780

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009471	2	59	PF06484	Teneurin intracellular
	IPR013111	269	295	PF07974	EGF
	IPR013111	333	360	PF07974	EGF
	IPR006209	365	392	PF00008	EGF-like
	IPR013111	432	458	PF07974	EGF
	IPR013111	463	489	PF07974	EGF
	IPR006209	494	524	PF00008	EGF-like
	IPR001258	923	951	PF01436	NHL repeat
	IPR001258	970	989	PF01436	NHL repeat
	IPR001258	1034	1059	PF01436	NHL repeat
	IPR001258	1093	1119	PF01436	NHL repeat
	IPR001258	1153	1180	PF01436	NHL repeat
	IPR001258	1222	1249	PF01436	NHL repeat
	IPR006530	1298	1335	PF05593	YD repeat
	IPR006530	1361	1399	PF05593	YD repeat
	IPR006530	1574	1610	PF05593	YD repeat
	IPR006530	1904	1942	PF05593	YD repeat
	IPR006530	1958	1996	PF05593	YD repeat
HMMSmart	IPR006210	268	296	SM00181	EGF
	IPR006210	299	327	SM00181	EGF
	IPR006210	332	361	SM00181	EGF
	IPR006210	364	393	SM00181	EGF
	IPR006210	398	428	SM00181	EGF
	IPR006210	431	459	SM00181	EGF
	IPR006210	462	490	SM00181	EGF
	IPR006210	493	525	SM00181	EGF
HMMTigr	IPR006530	1298	1339	TIGR01643	YD repeat
	IPR006530	1362	1403	TIGR01643	YD repeat
	IPR006530	1574	1614	TIGR01643	YD repeat
	IPR006530	1883	1924	TIGR01643	YD repeat
	IPR006530	1958	2000	TIGR01643	YD repeat
ProfileScan	IPR000742	265	296	PS50026	EGF-like
	IPR000742	361	393	PS50026	EGF-like
	IPR000742	395	428	PS50026	EGF-like
	IPR000742	490	525	PS50026	EGF-like
ScanRegExp	IPR013032	284	295	PS00022	EGF-like region
	IPR013032	284	295	PS01186	EGF-like region
	IPR013032	315	326	PS00022	EGF-like region
	IPR013032	315	326	PS01186	EGF-like region
	IPR013032	349	360	PS00022	EGF-like region
	IPR013032	349	360	PS01186	EGF-like region
	IPR013032	381	392	PS00022	EGF-like region
	IPR013032	381	392	PS01186	EGF-like region
	IPR013032	416	427	PS00022	EGF-like region
	IPR013032	447	458	PS00022	EGF-like region
	IPR013032	447	458	PS01186	EGF-like region
	IPR013032	478	489	PS00022	EGF-like region
	IPR013032	478	489	PS01186	EGF-like region
	IPR013032	513	524	PS00022	EGF-like region
	IPR013032	513	524	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	63	LCAVGVSVLLAILLSYFIAMHLF	85	PRIMARY	23

Primer_f	AATGGCAGTTGATAAGAATGG
Primer_r	TGGTGTCACAAGTTAAAGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATGGCAGTTGATAAGAATGG
Primer_r	TGGTGTCACAAGTTAAAGGTC
PCR product length	137 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles