Gene/Protein Characteristic Table for KIAA0246
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01662
Accession No D87433
Description stabilin 1
Clone name ef02679
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (7909 bp)
Predicted protein sequence (2589 aa)
Flexi ORF Clone FXC01662
Source
Rouge ID mKIAA0246 by Kazusa Mouse cDNA Project
Note We replaced ha04606, former representative clones for KIAA0246 with ef02679. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 7909 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 137 bp
Genome contig ID gi89161205f_52404411
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TAAAGGTGCCCTCAGCGGATGTGGGCCATGTCACC
Flanking genome sequence
(129140 - 129189)		 
----+----*----+----*----+----*----+----*----+----*
AAGGAAGGGGGTCTTCATGCAGCCGGTGCAGAGCTGGTCCATCCAGAGGG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 f 52504411 52533549 69 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 2589 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NY15 0 100.0 Stabilin-1; Fas...
 Homo sapiens
EAW65232 0 100.0 stabilin 1, iso...
 Homo sapiens
BAC15606 0 100.0 FELE-1 [Homo sa...
 Homo sapiens
NP_055951 0 99.9 stabilin 1 prec...
 Homo sapiens
ABG91068 0 99.9 FEX1 [Homo sapi...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011539 4.9e-18 25.1 KIAA0815
AB053450 1e-17 23.5 KIAA1776
AB058676 2.6e-15 26.0 KIAA1780
AB058677 2.7e-14 26.4 KIAA1781
AB067494 3.6e-11 23.7 KIAA1907
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000538 2226 2273 PD000918 Link
HMMPfam IPR013111 131 166 PF07974 EGF
IPR006209 255 289 PF00008 EGF-like
IPR000782 537 662 PF02469 Beta-Ig-H3/fasciclin
IPR006209 884 921 PF00008 EGF-like
IPR006209 970 1006 PF00008 EGF-like
IPR000782 1019 1139 PF02469 Beta-Ig-H3/fasciclin
IPR000782 1159 1232 PF02469 Beta-Ig-H3/fasciclin
IPR006209 1520 1557 PF00008 EGF-like
IPR000782 1625 1729 PF02469 Beta-Ig-H3/fasciclin
IPR000782 1755 1885 PF02469 Beta-Ig-H3/fasciclin
IPR002049 2011 2040 PF00053 EGF-like
IPR006209 2114 2149 PF00008 EGF-like
IPR006209 2155 2192 PF00008 EGF-like
IPR000538 2226 2319 PF00193 Link
HMMSmart IPR006210 130 167 SM00181 EGF
IPR002049 138 179 SM00180 EGF-like
IPR006210 178 212 SM00181 EGF
IPR002049 183 249 SM00180 EGF-like
IPR006210 217 250 SM00181 EGF
IPR006210 254 290 SM00181 EGF
IPR006210 294 337 SM00181 EGF
IPR006210 339 375 SM00181 EGF
IPR000782 417 517 SM00554 Beta-Ig-H3/fasciclin
IPR000782 561 663 SM00554 Beta-Ig-H3/fasciclin
IPR006210 747 787 SM00181 EGF
IPR006210 798 835 SM00181 EGF
IPR001881 840 879 SM00179 EGF-like calcium-binding
IPR006210 840 879 SM00181 EGF
IPR001881 882 922 SM00179 EGF-like calcium-binding
IPR006210 883 922 SM00181 EGF
IPR006210 926 965 SM00181 EGF
IPR006210 969 1007 SM00181 EGF
IPR000782 1041 1140 SM00554 Beta-Ig-H3/fasciclin
IPR000782 1183 1275 SM00554 Beta-Ig-H3/fasciclin
IPR006210 1350 1387 SM00181 EGF
IPR001881 1351 1387 SM00179 EGF-like calcium-binding
IPR002049 1359 1398 SM00180 EGF-like
IPR006210 1397 1431 SM00181 EGF
IPR006210 1438 1473 SM00181 EGF
IPR001881 1474 1515 SM00179 EGF-like calcium-binding
IPR006210 1477 1515 SM00181 EGF
IPR001881 1516 1558 SM00179 EGF-like calcium-binding
IPR006210 1519 1558 SM00181 EGF
IPR006210 1562 1601 SM00181 EGF
IPR000782 1634 1730 SM00554 Beta-Ig-H3/fasciclin
IPR000782 1781 1886 SM00554 Beta-Ig-H3/fasciclin
IPR001881 1986 2026 SM00179 EGF-like calcium-binding
IPR006210 1986 2026 SM00181 EGF
IPR002049 1987 2037 SM00180 EGF-like
IPR006210 2036 2070 SM00181 EGF
IPR006210 2078 2109 SM00181 EGF
IPR006210 2113 2150 SM00181 EGF
IPR006210 2154 2193 SM00181 EGF
IPR000538 2225 2320 SM00445 Link
IPR000782 2386 2481 SM00554 Beta-Ig-H3/fasciclin
ProfileScan IPR000742 129 167 PS50026 EGF-like
IPR000742 175 212 PS50026 EGF-like
IPR000742 214 248 PS50026 EGF-like
IPR000742 251 290 PS50026 EGF-like
IPR000782 375 513 PS50213 Beta-Ig-H3/fasciclin
IPR000782 525 660 PS50213 Beta-Ig-H3/fasciclin
IPR000742 747 787 PS50026 EGF-like
IPR000742 837 877 PS50026 EGF-like
IPR000742 880 922 PS50026 EGF-like
IPR000742 923 965 PS50026 EGF-like
IPR000742 966 1005 PS50026 EGF-like
IPR000782 1007 1137 PS50213 Beta-Ig-H3/fasciclin
IPR000782 1147 1272 PS50213 Beta-Ig-H3/fasciclin
IPR000742 1349 1387 PS50026 EGF-like
IPR000742 1394 1431 PS50026 EGF-like
IPR000742 1435 1473 PS50026 EGF-like
IPR000742 1474 1515 PS50026 EGF-like
IPR000742 1516 1558 PS50026 EGF-like
IPR000742 1559 1601 PS50026 EGF-like
IPR000782 1601 1727 PS50213 Beta-Ig-H3/fasciclin
IPR000782 1743 1883 PS50213 Beta-Ig-H3/fasciclin
IPR000742 1988 2026 PS50026 EGF-like
IPR000742 2033 2070 PS50026 EGF-like
IPR000742 2075 2109 PS50026 EGF-like
IPR000742 2110 2150 PS50026 EGF-like
IPR000742 2151 2193 PS50026 EGF-like
IPR000538 2227 2320 PS50963 Link
IPR000782 2341 2478 PS50213 Beta-Ig-H3/fasciclin
ScanRegExp IPR013032 155 166 PS00022 EGF-like region
IPR013032 200 211 PS00022 EGF-like region
IPR013032 200 211 PS01186 EGF-like region
IPR013032 236 249 PS01186 EGF-like region
IPR001128 744 753 PS00086 Cytochrome P450
IPR013032 775 786 PS00022 EGF-like region
IPR013032 865 878 PS01186 EGF-like region
IPR013032 908 921 PS01186 EGF-like region
IPR001128 914 923 PS00086 Cytochrome P450
IPR013032 951 964 PS01186 EGF-like region
IPR013032 993 1006 PS01186 EGF-like region
IPR013032 1375 1386 PS00022 EGF-like region
IPR013032 1375 1389 PS01186 EGF-like region
IPR002049 1375 1409 PS01248 EGF-like
IPR013032 1419 1430 PS00022 EGF-like region
IPR013032 1419 1430 PS01186 EGF-like region
IPR013032 1459 1472 PS01186 EGF-like region
IPR013032 1501 1514 PS01186 EGF-like region
IPR013032 1543 1557 PS01186 EGF-like region
IPR013032 2014 2025 PS00022 EGF-like region
IPR013032 2014 2028 PS01186 EGF-like region
IPR002049 2014 2048 PS01248 EGF-like
IPR013032 2058 2069 PS00022 EGF-like region
IPR013032 2058 2069 PS01186 EGF-like region
IPR013032 2095 2108 PS01186 EGF-like region
IPR013032 2179 2192 PS01186 EGF-like region
IPR000538 2249 2294 PS01241 Link
IPR013032 2326 2340 PS01186 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 21 AGPRGLLPLCLLAFCLAGFSFVR 43 PRIMARY 23
2 2452 GTVVVSRIIVWDIMAFNGIIHAL 2474 SECONDARY 23
3 2496 AAGVGAVLAAGALLGLVAGALYL 2518 PRIMARY 23
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name Genebridge 4
Primer_f TGATGCTGATGACGACTTCTC
Primer_r CAATAAAAGTGGTCTCCTCCC
PCR product length 216 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp