KIAA0546

Product ID	ORK00095
Accession No	AB011118
Description	zinc finger, C3H1-type containing
Clone name	ef04555
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7597 bp) Predicted protein sequence (1919 aa)
HaloTag ORF Clone	FHC00095
Flexi ORF Clone	FXC00095
Source
Rouge ID	mKIAA0546 by Kazusa Mouse cDNA Project
Note	We replaced hh00504, former representative clones for KIAA0546 with ef04555. (2003/4/2)

Length: 7597 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1655 bp
Genome contig ID	gi89161190r_70189745
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAGAAATTTTAATTTATAATAAAGTTTAACAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAACAGTTAATATTTGAACTGCTTTGTATTGAAATACTACTTTGTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	70289745	70343866	34	99.9	Perfect prediction

Length: 1919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW97263	100.0	proline/serine-...	Homo sapiens
O60293	99.9	Zinc finger C3H...	Homo sapiens
XP_509222	99.8	proline/serine-...	Pan troglodytes
XP_001117507	99.1	hypothetical pr...	Macaca mulatta
EAW97261	100.0	proline/serine-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003107	1390	1422	SM00386	RNA-processing protein
	IPR003107	1424	1455	SM00386	RNA-processing protein
	IPR003107	1659	1691	SM00386	RNA-processing protein
	IPR003107	1768	1803	SM00386	RNA-processing protein
ProfileScan	IPR013026	1370	1443	PS50293	Tetratricopeptide region
ProfileScan	IPR013026	1611	1678	PS50293	Tetratricopeptide region

Primer_f	GATGGCTGTTCTCCTTGTTAG
Primer_r	TCCTGTAGACTGTTCCTCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GATGGCTGTTCTCCTTGTTAG
Primer_r	TCCTGTAGACTGTTCCTCATC
PCR product length	154 (0.7k) bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles