Gene/Protein Characteristic Table for KIAA2024
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07274
Accession No AB095944
Description ubiquitin protein ligase E3 component n-recognin 3 (putative)
Clone name ff08438
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4047 bp)
Predicted protein sequence (437 aa)
Source Human fetal brain
Rouge ID mKIAA2024 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2270 bp
Genome contig ID gi89161199f_170479559
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AACATTGTAAGATATGTTAATAAAAACCTGCTGTC
Flanking genome sequence
(169304 - 169353)
----+----*----+----*----+----*----+----*----+----*
ATTTGGTTTGTGAAAGGTCCTTAAAATGTTTACTGCTTACATGTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 f 170579559 170648861 10 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 437 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAC87462 5.4e-207 100.0 unnamed protein...
Homo sapiens
BAC86783 5.5e-207 100.0 unnamed protein...
Homo sapiens
EAX11248 7e-207 100.0 zinc finger pro...
Homo sapiens
BAC87032 8.5e-207 99.8 unnamed protein...
Homo sapiens
Q6ZT12 1.1e-206 100.0 E3 ubiquitin-pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002347 1.4e-18 25.4 KIAA0349
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGTATAATCCCTGGAGAAAGC
Primer_r AAGGGTTGTGGCATCATTAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp