KIAA2024

Product ID	ORK07274
Accession No	AB095944
Description	ubiquitin protein ligase E3 component n-recognin 3 (putative)
Clone name	ff08438
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4047 bp) Predicted protein sequence (437 aa)
Source	Human fetal brain
Rouge ID	mKIAA2024 by Kazusa Mouse cDNA Project

Length: 4047 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2270 bp
Genome contig ID	gi89161199f_170479559
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AACATTGTAAGATATGTTAATAAAAACCTGCTGTC
Flanking genome sequence (169304 - 169353)	----+--------+--------+--------+--------+----* ATTTGGTTTGTGAAAGGTCCTTAAAATGTTTACTGCTTACATGTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	170579559	170648861	10	99.2	Perfect prediction

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC87462	5.4e-207	100.0	unnamed protein...	Homo sapiens
BAC86783	5.5e-207	100.0	unnamed protein...	Homo sapiens
EAX11248	7e-207	100.0	zinc finger pro...	Homo sapiens
BAC87032	8.5e-207	99.8	unnamed protein...	Homo sapiens
Q6ZT12	1.1e-206	100.0	E3 ubiquitin-pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002347	1.4e-18	25.4	KIAA0349

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AGTATAATCCCTGGAGAAAGC
Primer_r	AAGGGTTGTGGCATCATTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-