KIAA1199

Gene/Protein Characteristic Table for KIAA1199

Order Kazusa clone(s) from :

Product ID	ORK05642
Accession No	AB033025
Description	cell migration inducing protein, hyaluronan binding
Clone name	fg01973
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5776 bp) Predicted protein sequence (1013 aa)
Source	Human fetal brain

Length: 5776 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2734 bp
Genome contig ID	gi51511731f_78868947
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CACTGTCAGAGAAATAAAGAATTGTCTTAAATGTC
Flanking genome sequence (162109 - 162158)	----+--------+--------+--------+--------+----* ATGATTGGAGATGTCCTTTGCATTGCTTGGAAGGGGTGTACCTAGAGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	78968947	79031054	21	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 1013 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDM08762	0	94.9	rCG24762 [Rattu...	Rattus norvegicus
BAC29586	0	94.8	unnamed protein...	Mus musculus
XP_001141007	5.6e-194	48.6	transmembrane p...	Pan troglodytes
EAW62519	5.8e-194	48.8	transmembrane p...	Homo sapiens
Q9UHN6	6.5e-194	48.8	Transmembrane p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037833	3.6e-198	48.8	KIAA1412

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTAAACCATTCACCAAGAGCC
Primer_r	GACAAGCATTTCAGAGGAGCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 15

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTAAACCATTCACCAAGAGCC
Primer_r	GACAAGCATTTCAGAGGAGCG
PCR product length	153 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp