KIAA0978

Product ID	ORK04195
Accession No	AB023195
Description	additional sex combs like transcriptional regulator 1
Clone name	fg02182
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6088 bp) Predicted protein sequence (1368 aa)
Source	Human fetal brain
Rouge ID	mKIAA0978 by Kazusa Mouse cDNA Project
Note	We replaced hj07040, former representative clones for KIAA0978 with fg02182. (2002/5/10)

Length: 6088 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1980 bp
Genome contig ID	gi51511747f_30380849
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTGGTATTGGAACAATAAACCCGTACAACCTGC
Flanking genome sequence (109935 - 109984)	----+--------+--------+--------+--------+----* AGTTGTGGTCTCAGTCATCTGTGGCTGCCTCGCTGGTGTGGGAAGGTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	30480849	30490782	7	99.2	Perfect prediction

Length: 1368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW76377	100.0	additional sex ...	Homo sapiens
BAD00087	100.0	polycomb group ...	Homo sapiens
EAW76378	100.0	additional sex ...	Homo sapiens
Q8IXJ9	100.0	Putative Polyco...	Homo sapiens
CAD27708	99.9	additional sex ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051472	3.4e-17	28.3	KIAA1685
AB051500	2.2e-07	24.0	KIAA1713

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CAAGTTGGGAATGATGTGGTG
Primer_r	TGTCCCCAAAGGTTCCAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-