KIAA0395

Product ID	ORK07426
Accession No	AB007855
Description	zinc fingers and homeoboxes 3
Clone name	fg04028s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6297 bp) Predicted protein sequence (1003 aa)
Source	Human fetal brain
Rouge ID	mKIAA0395 by Kazusa Mouse cDNA Project
Note	We replaced hf00285 and fg04028, former representative clones for KIAA0395 with fg04028s1. (2002/5/10,2005/08/06)

Length: 6297 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3077 bp
Genome contig ID	gi51511747r_39144169
PolyA signal sequence (GATAAA,-21)	+--------+--------+----*----+---- CAGATGATCATTCTGATAAAGGAAATTTAAATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACATATGCTTTGTATATTTTGATTACTTGTTTTCGTTTTTGACTATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	39244169	39331139	3	99.0	Terminal No-hit

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001141515	99.3	zinc fingers an...	Pan troglodytes
Q9H4I2	99.9	Zinc fingers an...	Homo sapiens
BAF85104	99.8	unnamed protein...	Homo sapiens
XP_001086350	97.9	similar to zinc...	Macaca mulatta
AAH68569	93.4	ZHX3 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020661	6.2e-16	33.4	KIAA0854
AB037864	1.5e-06	22.8	KIAA1443

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	554	597	PD000010	Homeobox
HMMPfam	IPR001356	545	598	PF00046	Homeobox
HMMPfam	IPR001356	663	713	PF00046	Homeobox
HMMSmart	IPR015880	124	147	SM00355	Zinc finger
	IPR015880	156	179	SM00355	Zinc finger
	IPR001356	351	413	SM00389	Homeobox
	IPR001356	541	603	SM00389	Homeobox
	IPR001356	660	721	SM00389	Homeobox
	IPR001356	811	873	SM00389	Homeobox
ProfileScan	IPR001356	366	409	PS50071	Homeobox
	IPR001356	549	599	PS50071	Homeobox
	IPR001356	669	717	PS50071	Homeobox
	IPR001356	819	869	PS50071	Homeobox

Panel name
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-