KIAA1846

Product ID	ORK04033
Accession No	AB058749
Description	acyl-CoA synthetase short-chain family member 1
Clone name	fg06344s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2597 bp) Predicted protein sequence (354 aa)
Source	Human fetal brain
Rouge ID	mKIAA1846 by Kazusa Mouse cDNA Project
Note	We replaced fg06344, former representative clones for KIAA1846 with fg06344s1. (2002/5/10)

Length: 2597 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1530 bp
Genome contig ID	gi51511747r_24834868
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GGGAGTTCAAATAAAGCTTTATTTTGTTCATTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCTTTGTGGTGATTTTTTTGGGTCCAGTAATGCTACTCTTTTTTTTTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	24934868	24950129	9	99.3	Perfect prediction

Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC03853	2e-150	100.0	unnamed protein...	Homo sapiens
XP_001149649	2.3e-150	100.0	acyl-CoA synthe...	Pan troglodytes
XP_001149714	2.4e-150	100.0	acyl-CoA synthe...	Pan troglodytes
BAC86035	2.6e-150	100.0	unnamed protein...	Homo sapiens
XP_001149851	2.8e-150	100.0	acyl-CoA synthe...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000873	1	245	PF00501	AMP-dependent synthetase and ligase

Primer_f	GAGCTATTGCAAGTCTGGTGT
Primer_r	TATTCACAGGCAGCTTTAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-