KIAA1211

Gene/Protein Characteristic Table for KIAA1211

Order Kazusa clone(s) from :

Product ID	ORK07577
Accession No	AB033037
Description	KIAA1211
Clone name	fh00041
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5217 bp) Predicted protein sequence (803 aa)
Source	Human fetal brain
Rouge ID	mKIAA1211 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5217 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2803 bp
Genome contig ID	gi89161207f_56775517
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGGAAAAGATCTTTCAATAAAAAATACCCACGAG
Flanking genome sequence (116016 - 116065)	----+--------+--------+--------+--------+----* ATCTTCGGCACTGATGGAATTTGATTTCGATGACCAACTGCAAAACAATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	56875517	56891531	5	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI44537	1.1e-209	98.7	Unknown (protei...	Homo sapiens
AAI71783	9.9e-209	98.5	Unknown (protei...	Homo sapiens
BAC86392	2.4e-208	98.3	unnamed protein...	Homo sapiens
XP_526620	2.6e-207	97.8	hypothetical pr...	Pan troglodytes
XP_001086058	4e-200	95.7	similar to seri...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGTGGATTCATAGTGTGGGGC
Primer_r	AGTGAACTTGTAGCTCTGATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 4

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp