Order Kazusa clone(s) from : ![]() |
Product ID | ORK00793 |
---|---|
Accession No | AB033102 |
Description | family with sequence similarity 184, member B |
Clone name | fh00139s1 |
Vector information | |
cDNA sequence | DNA sequence (3653 bp) Predicted protein sequence (1068 aa) |
HaloTag ORF Clone |
FHC00793
![]() |
Flexi ORF Clone | FXC00793 |
Source | Human fetal brain |
Note | We replaced fh00139, former representative clones for KIAA1276 with fh00139s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 444 bp |
---|---|
Genome contig ID | gi89161207r_17143095 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99714 - 99665) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 17242809 | 17392046 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CTTTCTGAGTGGCGATCTGAG |
---|---|
Primer_r | TAGACTGGTTGGGTTTGTAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTTCTGAGTGGCGATCTGAG |
Primer_r | TAGACTGGTTGGGTTTGTAGG |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |