KIAA1029

Gene/Protein Characteristic Table for KIAA1029

Order Kazusa clone(s) from :

Product ID	ORK00717
Accession No	AB028952
Description	synaptopodin, transcript variant 1
Clone name	fh00363
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5332 bp) Predicted protein sequence (1015 aa)
HaloTag ORF Clone	FHC00717
Flexi ORF Clone	FXC00717
Source	Human fetal brain
Rouge ID	mKIAA1029 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5332 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2124 bp
Genome contig ID	gi51511721f_149900446
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGCAGCTCTGGCCCTCAATAAATGCTTCCTGCATT
Flanking genome sequence (118518 - 118567)	----+--------+--------+--------+--------+----* CTTCTGCCTCCTGTGTCATTTTCAGCTGTGTCTGATGTCCTTCCCTTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	150000446	150018962	3	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 1015 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_527075	0	98.9	synaptopodin [P...	Pan troglodytes
XP_001099989	0	96.9	similar to syna...	Macaca mulatta
AAQ07402	0	100.0	synaptopodin [H...	Homo sapiens
AAI52539	1.1e-216	100.0	SYNPO protein [...	Homo sapiens
Q8N3V7	3.1e-186	99.4	Synaptopodin.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TCCCTGTCATGCTACTTTCTC
Primer_r	ATGGTAGCTCTGTATCTCTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 5

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp