Order Kazusa clone(s) from : ![]() |
Product ID | ORK05357 |
---|---|
Accession No | AB033046 |
Description | glutamate receptor, ionotropic, delta 1 |
Clone name | fh03489 |
Vector information | |
cDNA sequence | DNA sequence (5097 bp) Predicted protein sequence (791 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2719 bp |
---|---|
Genome contig ID | gi89161187r_87249292 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 87349292 | 87888629 | 12 | 99.4 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 409 | 474 | PD245531 | NULL |
FPrintScan | IPR001508 | 262 | 290 | PR00177 | NMDA receptor |
IPR001508 | 347 | 372 | PR00177 | NMDA receptor | |
IPR001508 | 414 | 441 | PR00177 | NMDA receptor | |
IPR001508 | 613 | 637 | PR00177 | NMDA receptor | |
HMMPfam | IPR001828 | 1 | 183 | PF01094 | Extracellular ligand-binding receptor |
IPR001638 | 245 | 329 | PF00497 | Bacterial extracellular solute-binding protein | |
IPR001320 | 344 | 634 | PF00060 | Ionotropic glutamate receptor | |
HMMSmart | IPR001320 | 220 | 589 | SM00079 | Ionotropic glutamate receptor |
ScanRegExp | IPR002086 | 685 | 692 | PS00687 | Aldehyde dehydrogenase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 340 | FAPFDFAVWACIAAAIPVVGVLI | 362 | PRIMARY | 23 | 2 | 382 | SASATLHSAIWIVYGAFVQQGGE | 404 | SECONDARY | 23 | 3 | 413 | RIVMGSWWLFTLIVCSSYTANLA | 435 | SECONDARY | 23 | 4 | 612 | SFAGVFCILAIGLLLACLVAALE | 634 | PRIMARY | 23 |
---|
![]() |
Primer_f | ATCAAACTCTGGTCTCACTGC |
---|---|
Primer_r | GAAGACATCCAAGCTATACCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCAAACTCTGGTCTCACTGC |
Primer_r | GAAGACATCCAAGCTATACCC |
PCR product length | 97 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |