Gene/Protein Characteristic Table for KIAA1221
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07503
Accession No AB033047
Description zinc finger protein 644
Clone name fh03522
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5346 bp)
Predicted protein sequence (1282 aa)
Source Human fetal brain
Rouge ID mKIAA1221 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5346 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1496 bp
Genome contig ID gi89161185r_91053447
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAAATCTCTAAATAAAAAAAGGTTTAAAGAAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGTGAAACATTTCTTATTTTTATCATTGGTGGTAATAGTTCACTTC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 r 91153447 91179364 4 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 1282 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH63683 0 100.0 ZNF644 protein ...
Homo sapiens
Q9H582 0 100.0 Zinc finger pro...
Homo sapiens
AAI50178 0 99.8 ZNF644 protein ...
Homo sapiens
XP_001493620 0 94.4 similar to MGC1...
Equus caballus
XP_853224 0 94.7 similar to zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007886 5.9e-05 21.3 KIAA0426
AB058774 0.00028 24.1 KIAA1871
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 365 387 PF00096 Zinc finger
IPR007087 403 425 PF00096 Zinc finger
HMMSmart IPR015880 365 387 SM00355 Zinc finger
IPR015880 403 425 SM00355 Zinc finger
IPR015880 451 473 SM00355 Zinc finger
IPR015880 480 503 SM00355 Zinc finger
IPR015880 541 564 SM00355 Zinc finger
IPR015880 918 940 SM00355 Zinc finger
IPR015880 993 1015 SM00355 Zinc finger
IPR015880 1216 1242 SM00355 Zinc finger
ProfileScan IPR007087 365 392 PS50157 Zinc finger
IPR007087 403 430 PS50157 Zinc finger
IPR007087 993 1015 PS50157 Zinc finger
ScanRegExp IPR007087 367 387 PS00028 Zinc finger
IPR007087 405 425 PS00028 Zinc finger
IPR007087 920 942 PS00028 Zinc finger
IPR007087 995 1015 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTGCTGACGAGGTTTACATTC
Primer_r TGAAGTTTCTGTAATGGAGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp