KIAA1221

Product ID	ORK07503
Accession No	AB033047
Description	zinc finger protein 644
Clone name	fh03522
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5346 bp) Predicted protein sequence (1282 aa)
Source	Human fetal brain
Rouge ID	mKIAA1221 by Kazusa Mouse cDNA Project

Length: 5346 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1496 bp
Genome contig ID	gi89161185r_91053447
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAAATCTCTAAATAAAAAAAGGTTTAAAGAAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTGAAACATTTCTTATTTTTATCATTGGTGGTAATAGTTCACTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	91153447	91179364	4	100.0	Perfect prediction

Length: 1282 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH63683	100.0	ZNF644 protein ...	Homo sapiens
Q9H582	100.0	Zinc finger pro...	Homo sapiens
AAI50178	99.8	ZNF644 protein ...	Homo sapiens
XP_001493620	94.4	similar to MGC1...	Equus caballus
XP_853224	94.7	similar to zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007886	5.9e-05	21.3	KIAA0426
AB058774	0.00028	24.1	KIAA1871

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	365	387	PF00096	Zinc finger
HMMPfam	IPR007087	403	425	PF00096	Zinc finger
HMMSmart	IPR015880	365	387	SM00355	Zinc finger
	IPR015880	403	425	SM00355	Zinc finger
	IPR015880	451	473	SM00355	Zinc finger
	IPR015880	480	503	SM00355	Zinc finger
	IPR015880	541	564	SM00355	Zinc finger
	IPR015880	918	940	SM00355	Zinc finger
	IPR015880	993	1015	SM00355	Zinc finger
	IPR015880	1216	1242	SM00355	Zinc finger
ProfileScan	IPR007087	365	392	PS50157	Zinc finger
	IPR007087	403	430	PS50157	Zinc finger
	IPR007087	993	1015	PS50157	Zinc finger
ScanRegExp	IPR007087	367	387	PS00028	Zinc finger
	IPR007087	405	425	PS00028	Zinc finger
	IPR007087	920	942	PS00028	Zinc finger
	IPR007087	995	1015	PS00028	Zinc finger

Primer_f	GTGCTGACGAGGTTTACATTC
Primer_r	TGAAGTTTCTGTAATGGAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-