Order Kazusa clone(s) from : ![]() |
Product ID | ORK06461 |
---|---|
Accession No | AB033048 |
Description | protein phosphatase 1, regulatory subunit 9A |
Clone name | fh03567 |
Vector information | |
cDNA sequence | DNA sequence (5357 bp) Predicted protein sequence (742 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1222
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3126 bp |
---|---|
Genome contig ID | gi89161213f_94278428 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (482251 - 482300) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 94378428 | 94760677 | 15 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 148 | 233 | PF00595 | PDZ/DHR/GLGF |
IPR011510 | 629 | 695 | PF07647 | Sterile alpha motif homology 2 | |
HMMSmart | IPR001478 | 156 | 236 | SM00228 | PDZ/DHR/GLGF |
IPR001660 | 629 | 695 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR001478 | 148 | 236 | PS50106 | PDZ/DHR/GLGF |
IPR001660 | 632 | 695 | PS50105 | Sterile alpha motif SAM |
![]() |
Primer_f | TGCTAGTGGTTTTCAGTGTCC |
---|---|
Primer_r | TCCCTCCCAACAAAGCATAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCTAGTGGTTTTCAGTGTCC |
Primer_r | TCCCTCCCAACAAAGCATAAC |
PCR product length | 202 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |