KIAA1222

Product ID	ORK06461
Accession No	AB033048
Description	protein phosphatase 1, regulatory subunit 9A
Clone name	fh03567
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5357 bp) Predicted protein sequence (742 aa)
Source	Human fetal brain
Rouge ID	mKIAA1222 by Kazusa Mouse cDNA Project

Length: 5357 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3126 bp
Genome contig ID	gi89161213f_94278428
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- ATGACAATAAAGCTGTTCTGTGGCTATCATCCTTT
Flanking genome sequence (482251 - 482300)	----+--------+--------+--------+--------+----* AGCTGGGATTGACAATTGATTTCACACCCTCAACATCACAAGCTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	94378428	94760677	15	100.0	Perfect prediction

Length: 742 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULJ8	100.0	Neurabin-1; Neu...	Homo sapiens
XP_001169436	99.9	protein phospha...	Pan troglodytes
AAI44110	98.9	PPP1R9A protein...	Homo sapiens
XP_860839	96.6	similar to Neur...	Canis lupus fam...
XP_001493393	96.0	similar to prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	148	233	PF00595	PDZ/DHR/GLGF
HMMPfam	IPR011510	629	695	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001478	156	236	SM00228	PDZ/DHR/GLGF
HMMSmart	IPR001660	629	695	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001478	148	236	PS50106	PDZ/DHR/GLGF
ProfileScan	IPR001660	632	695	PS50105	Sterile alpha motif SAM

Primer_f	TGCTAGTGGTTTTCAGTGTCC
Primer_r	TCCCTCCCAACAAAGCATAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCTAGTGGTTTTCAGTGTCC
Primer_r	TCCCTCCCAACAAAGCATAAC
PCR product length	202 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles