KIAA1448

Product ID	ORK01166
Accession No	AB040881
Description	kinesin family member 1B, transcript variant 2
Clone name	fh12320y1
Vector information	The cDNA fragment was originally inserted at Sal I-NotI site ... The cDNA fragment was originally inserted at Sal I-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GTCGACCCAC GCGTCCG-5' end of cDNA.
cDNA sequence	DNA sequence (5883 bp) Predicted protein sequence (1179 aa)
HaloTag ORF Clone	FHC01166
Flexi ORF Clone	FXC01166
Source	Human fetal brain
Note	We replaced fh12320, former representative clones for KIAA1448 with fh12320y1. (2002/12/27)

Length: 5883 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2110 bp
Genome contig ID	gi89161185f_10113409
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGCAGCCAGGACAACAGAGTGAGAACCTGTCTTT
Flanking genome sequence (175995 - 176044)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAGGTAATATTTATTATATTATTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	10213409	10289402	21	99.9	Perfect prediction

Length: 1179 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI95222	100.0	kinesin family ...	Homo sapiens
AAK85155	98.8	kinesin superfa...	Homo sapiens
CAM18594	95.7	kinesin family ...	Mus musculus
BAA04503	95.2	Kif1b [Mus musc...	Mus musculus
EAW71645	100.0	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011163	3.8e-106	92.4	KIAA0591
AB014606	2.4e-88	62.2	KIAA0706
AB014539	1.4e-59	48.1	KIAA0639
AB046810	5.3e-53	35.3	KIAA1590
D26361	1.5e-48	36.2	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	114	135	PR00380	Kinesin
	IPR001752	234	251	PR00380	Kinesin
	IPR001752	269	287	PR00380	Kinesin
	IPR001752	324	345	PR00380	Kinesin
HMMPfam	IPR001752	37	375	PF00225	Kinesin
HMMPfam	IPR000253	536	607	PF00498	Forkhead-associated
HMMSmart	IPR001752	29	382	SM00129	Kinesin
HMMSmart	IPR000253	535	592	SM00240	Forkhead-associated
ProfileScan	IPR001752	28	299	PS50067	Kinesin
ProfileScan	IPR000253	536	592	PS50006	Forkhead-associated
ScanRegExp	IPR001752	268	279	PS00411	Kinesin

Primer_f	TACATCGTTCCTCATCTCTTG
Primer_r	CCTTGAATGCTAACTGCTATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-