KIAA1317

Product ID	ORK00800
Accession No	AB037738
Description	potassium channel tetramerization domain containing 16
Clone name	fh13117
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5646 bp) Predicted protein sequence (435 aa)
HaloTag ORF Clone	FHC00800
Flexi ORF Clone	FXC00800
Source	Human fetal brain
Rouge ID	mKIAA1317 by Kazusa Mouse cDNA Project

Length: 5646 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3268 bp
Genome contig ID	gi51511721f_143465033
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GTGAATTAAAATAAAAGGGGGAACAATGCACAAAT
Flanking genome sequence (372106 - 372155)	----+--------+--------+--------+--------+----* AATAAGCGTTCCCTTTGCTCTTTATTCCTTTATAGTTGTATCTATTCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	143565033	143837137	3	99.3	Perfect prediction

Length: 435 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q68DU8	2.1e-178	100.0	BTB/POZ domain-...	Homo sapiens
BAF85166	1e-177	99.8	unnamed protein...	Homo sapiens
XP_001098121	1.4e-177	99.3	similar to pota...	Macaca mulatta
XP_001917937	3.5e-176	98.1	potassium chann...	Equus caballus
XP_544324	2e-175	97.7	similar to pota...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AF359381	9.5e-29	56.0	KIAA1778
D79998	2.8e-06	30.1	KIAA0176

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	34	129	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	32	137	SM00225	BTB/POZ-like

Primer_f	ATGTGTAGAGCCCCAACTTAG
Primer_r	GACAACCCACATACCTTTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGTGTAGAGCCCCAACTTAG
Primer_r	GACAACCCACATACCTTTAGG
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles