Order Kazusa clone(s) from : ![]() |
Product ID | ORK00802 |
---|---|
Accession No | AB037743 |
Description | TBC1 domain family, member 14, transcript variant 1 |
Clone name | fh13826 |
Vector information | |
cDNA sequence | DNA sequence (4832 bp) Predicted protein sequence (702 aa) |
HaloTag ORF Clone |
FHC00802
![]() |
Flexi ORF Clone | FXC00802 |
Source | Human fetal brain |
Rouge ID |
mKIAA1322
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2721 bp |
---|---|
Genome contig ID | gi89161207f_6875999 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (209744 - 209793) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 6975999 | 7085741 | 13 | 99.3 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GCTGTTGGCAAGTGTAGAGGC |
---|---|
Primer_r | TGTGAAGTGGAGTGTGCAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCTGTTGGCAAGTGTAGAGGC |
Primer_r | TGTGAAGTGGAGTGTGCAGAC |
PCR product length | 103 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |