KIAA1322

Product ID	ORK00802
Accession No	AB037743
Description	TBC1 domain family, member 14, transcript variant 1
Clone name	fh13826
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4832 bp) Predicted protein sequence (702 aa)
HaloTag ORF Clone	FHC00802
Flexi ORF Clone	FXC00802
Source	Human fetal brain
Rouge ID	mKIAA1322 by Kazusa Mouse cDNA Project

Length: 4832 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2721 bp
Genome contig ID	gi89161207f_6875999
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TGGTTTTATTAAATAAAAGTCAATGTAAAATTGTT
Flanking genome sequence (209744 - 209793)	----+--------+--------+--------+--------+----* ACTTATGTTCACCATCGTTTGTTTAAAGTTGAAGTTCTCACTTTGAGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	6975999	7085741	13	99.3	Terminal No-hit

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526514	99.7	TBC1 domain fam...	Pan troglodytes
XP_001118829	98.9	similar to TBC1...	Macaca mulatta
BAG10032	100.0	TBC1 domain fam...	synthetic construct
Q9P2M4	99.9	TBC1 domain fam...	Homo sapiens
AAH41167	99.9	TBC1 domain fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011180	1.4e-93	70.6	KIAA0608
D13644	7.7e-10	26.9	KIAA0019
AB029031	6.1e-09	20.8	KIAA1108
AB011175	1.3e-08	21.2	KIAA0603
AB028978	5.9e-07	23.4	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	409	641	PF00566	RabGAP/TBC
HMMSmart	IPR000195	407	643	SM00164	RabGAP/TBC
ProfileScan	IPR000195	410	620	PS50086	RabGAP/TBC

Primer_f	GCTGTTGGCAAGTGTAGAGGC
Primer_r	TGTGAAGTGGAGTGTGCAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCTGTTGGCAAGTGTAGAGGC
Primer_r	TGTGAAGTGGAGTGTGCAGAC
PCR product length	103 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles