KIAA1453

Product ID	ORK00841
Accession No	AB040886
Description	ubiquitin specific peptidase 36
Clone name	fh14729
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5879 bp) Predicted protein sequence (1123 aa)
HaloTag ORF Clone	FHC00841
Flexi ORF Clone	FXC00841
Source	Human fetal brain
Rouge ID	mKIAA1453 by Kazusa Mouse cDNA Project

Length: 5879 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2295 bp
Genome contig ID	gi51511734r_74195144
PolyA signal sequence (None)	+--------+--------+----*----+---- TACATTGATTTTGATTACAAATGGTTCTGTATTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACCACCGTTCTGACTGCTTTTTTCACTTATAGCTTGGAAATTGTCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	74295144	74348457	21	99.4	Perfect prediction

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10071	100.0	ubiquitin carbo...	synthetic construct
Q9P275	99.8	Ubiquitin carbo...	Homo sapiens
EAW89534	99.6	ubiquitin speci...	Homo sapiens
AAH71582	99.6	USP36 protein [...	Homo sapiens
XP_001108648	92.3	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028986	0.00014	29.4	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	121	422	PF00443	Peptidase C19
ProfileScan	IPR001394	124	426	PS50235	Peptidase C19
ScanRegExp	IPR001394	125	140	PS00972	Peptidase C19
	IPR001394	367	385	PS00973	Peptidase C19
	IPR003006	378	384	PS00290	Immunoglobulin/major histocompatibility complex motif

Primer_f	TCTGGCTGCTCTTCATTGACC
Primer_r	TACATGCTACTCGTTTACAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TCTGGCTGCTCTTCATTGACC
Primer_r	TACATGCTACTCGTTTACAGG
PCR product length	104 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles