Order Kazusa clone(s) from : ![]() |
Product ID | ORK00216 |
---|---|
Accession No | AB037754 |
Description | G2/M-phase specific E3 ubiquitin protein ligase, transcript variant 1 |
Clone name | fh15412 |
Vector information | |
cDNA sequence | DNA sequence (5534 bp) Predicted protein sequence (741 aa) |
HaloTag ORF Clone |
FHC00216
![]() |
Flexi ORF Clone | FXC00216 |
Source | Human fetal brain |
Rouge ID |
mKIAA1333
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3307 bp |
---|---|
Genome contig ID | gi51511730f_29998128 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (160671 - 160720) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 30098128 | 30158797 | 15 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTTGGAACAGTTACTTACAGG |
---|---|
Primer_r | AAAATCCACATGCAGACACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |