KIAA1334

Product ID	ORK00805
Accession No	AB037755
Description	retinoic acid induced 14, transcript variant 1
Clone name	fh15842
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5043 bp) Predicted protein sequence (989 aa)
HaloTag ORF Clone	FHC00805
Flexi ORF Clone	FXC00805
Source	Human fetal brain
Rouge ID	mKIAA1334 by Kazusa Mouse cDNA Project

Length: 5043 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1846 bp
Genome contig ID	gi51511721f_34592353
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAGTTATTGGAGAAAATAAACTTGTTTCATTTTGC
Flanking genome sequence (276122 - 276171)	----+--------+--------+--------+--------+----* ATTTCTGGTGTTGATTTTTGGTGTATTCAGAAGCATATCTGCGTGGCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	34692353	34868473	18	99.3	Perfect prediction

Length: 989 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH52988	100.0	Retinoic acid i...	Homo sapiens
Q9P0K7	99.9	Ankycorbin; Ank...	Homo sapiens
AAF44722	99.7	novel retinal p...	Homo sapiens
XP_001151811	99.6	retinoic acid i...	Pan troglodytes
XP_001089076	98.7	similar to reti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046781	2.3e-22	27.2	KIAA1561
AB075861	4.5e-17	29.0	KIAA1981
AB028997	1.7e-06	21.6	KIAA1074
AB095935	7.6e-06	21.0	KIAA2015
AB033049	2.2e-05	25.5	KIAA1223

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	62	74	PR01415	Ankyrin
FPrintScan	IPR002110	173	185	PR01415	Ankyrin
HMMPfam	IPR002110	27	60	PF00023	Ankyrin
	IPR002110	61	93	PF00023	Ankyrin
	IPR002110	94	126	PF00023	Ankyrin
	IPR002110	127	159	PF00023	Ankyrin
	IPR002110	160	192	PF00023	Ankyrin
	IPR002110	193	225	PF00023	Ankyrin
	IPR002110	226	261	PF00023	Ankyrin
HMMSmart	IPR002110	61	90	SM00248	Ankyrin
	IPR002110	94	126	SM00248	Ankyrin
	IPR002110	127	156	SM00248	Ankyrin
	IPR002110	160	189	SM00248	Ankyrin
	IPR002110	193	222	SM00248	Ankyrin
	IPR002110	226	256	SM00248	Ankyrin
ProfileScan	IPR002110	27	249	PS50297	Ankyrin
	IPR002110	61	93	PS50088	Ankyrin
	IPR002110	94	126	PS50088	Ankyrin
	IPR002110	127	159	PS50088	Ankyrin
	IPR002110	160	192	PS50088	Ankyrin
	IPR002110	193	225	PS50088	Ankyrin

Primer_f	GTGACAGCCCAAGATACTACC
Primer_r	GAGCCGCTGCATAATGTAAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-