KIAA1631

Product ID	ORK06023
Accession No	AB046851
Description	Mov10 RISC complex RNA helicase, transcript variant 3
Clone name	fh15959s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4100 bp) Predicted protein sequence (1032 aa)
Source	Human fetal brain
Rouge ID	mKIAA1631 by Kazusa Mouse cDNA Project
Note	We replaced fh15959, former representative clones for KIAA1631 with fh15959s1. (2002/5/10)

Length: 4100 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	227 bp
Genome contig ID	gi89161185f_112918972
PolyA signal sequence (AAGAAA,-33)	+--------+--------+----*----+---- GGAAGAAAACTCTGAAAACAAAATCTTGTTCTATG
Flanking genome sequence (125909 - 125958)	----+--------+--------+--------+--------+----* CAAAAGCCTTGATAATGTCTCCTCTGCCTGGCCCCAGCTTCCTGAGCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	113018843	113044879	22	100.0	Perfect prediction

Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCE1	100.0	Putative helica...	Homo sapiens
XP_513630	100.0	Mov10, Moloney ...	Pan troglodytes
ABM87844	99.9	Mov10, Moloney ...	synthetic construct
CAL37885	99.7	hypothetical pr...	synthetic construct
XP_001108355	99.0	similar to Mov1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29677	1.6e-08	29.8	KIAA0054
AB051556	2e-07	25.8	KIAA1769
D86988	0.00013	30.5	KIAA0221

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000886	1029	1032	PS00014	Endoplasmic reticulum targeting sequence

Primer_f	TGTCTTCCCTCAGTCCTTCCA
Primer_r	GGATCGGAGGAATGTTTAATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-