KIAA0654

Product ID	ORK00592
Accession No	AB014554
Description	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3, transcript variant 1
Clone name	fh18335
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4716 bp) Predicted protein sequence (1267 aa)
HaloTag ORF Clone	FHC00592
Flexi ORF Clone	FXC00592
Source	Human fetal brain
Note	We replaced hk01750, former representative clones for KIAA0654 with fh18335. (2001/5/29)

Length: 4716 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	799 bp
Genome contig ID	gi42406306f_54214475
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCACTCAGTGATCACGGGTAAAGAGAACTGTTTC
Flanking genome sequence (131617 - 131666)	----+--------+--------+--------+--------+----* AAAAAGCTTCCTTGTTGACTGATTTTTTTTTTGCGGGGGGGGGGGGGGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	54314475	54346090	30	99.8	Perfect prediction

Length: 1267 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75145	100.0	Liprin-alpha-3;...	Homo sapiens
AAI01519	99.9	Protein tyrosin...	Homo sapiens
XP_581408	99.2	similar to PTPR...	Bos taurus
XP_341857	94.7	similar to Lipr...	Rattus norvegicus
ACE63189	98.1	liprin-alpha 3 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020704	5.5e-40	66.7	KIAA0897
AB033056	0.00019	24.3	KIAA1230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	909	975	PF00536	Sterile alpha motif SAM
	IPR001660	1024	1088	PF00536	Sterile alpha motif SAM
	IPR011510	1111	1183	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	908	977	SM00454	Sterile alpha motif SAM
	IPR001660	1023	1090	SM00454	Sterile alpha motif SAM
	IPR001660	1111	1183	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	911	977	PS50105	Sterile alpha motif SAM
	IPR001660	1033	1090	PS50105	Sterile alpha motif SAM
	IPR001660	1114	1183	PS50105	Sterile alpha motif SAM

Primer_f	GGGATTATGTGCCTGAAACGG
Primer_r	TCGTGGCAAATTCCTTCAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGATTATGTGCCTGAAACGG
Primer_r	TCGTGGCAAATTCCTTCAGGC
PCR product length	154 (0.4k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles