KIAA1633

Product ID	ORK04518
Accession No	AB046853
Description	CDK5 regulatory subunit associated protein 2, transcript variant 2
Clone name	fh23696
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5966 bp) Predicted protein sequence (1852 aa)
HaloTag ORF Clone	FHC04518
Flexi ORF Clone	FXC04518
Source	Human fetal brain
Rouge ID	mKIAA1633 by Kazusa Mouse cDNA Project
Note	We replaced fh19672, former representative clones for KIAA1633 with fh23696. (2004/6/03)

Length: 5966 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	360 bp
Genome contig ID	gi89161216r_122090975
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TTTGAAGATTCTCATTAAATGATTCATTTCATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTGACGATTCTGTTGTTTTGTGTGGCGCCTCAAAGCCCAGGTCCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	122190975	122382238	37	99.9	Perfect prediction

Length: 1852 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW87459	100.0	CDK5 regulatory...	Homo sapiens
NP_001011649	99.9	CDK5 regulatory...	Homo sapiens
AAI43763	99.9	CDK5 regulatory...	Homo sapiens
CAD97828	99.5	hypothetical pr...	Homo sapiens
EAW87463	95.8	CDK5 regulatory...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007923	5.3e-11	24.8	KIAA0454
AB020673	4.9e-05	21.8	KIAA0866
AB007946	0.0001	21.3	KIAA0477
AB023166	0.00021	22.6	KIAA0949

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012943	108	170	PF07989	Spindle associated

Primer_f	TCTGTGTCATCTCCCGTCAAC
Primer_r	TCCACTCCAACTGATTTTCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-