Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04412 |
---|---|
Accession No | AB046793 |
Description | cache domain containing 1 |
Clone name | fh23868 |
Vector information | |
cDNA sequence | DNA sequence (5050 bp) Predicted protein sequence (1185 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1573
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1491 bp |
---|---|
Genome contig ID | gi89161185f_64720440 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (210885 - 210934) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 64820432 | 64931323 | 25 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013608 | 1 | 115 | PF08399 | VWA N-terminal |
IPR002035 | 139 | 334 | PF00092 | von Willebrand factor | |
IPR004010 | 364 | 443 | PF02743 | Cache | |
IPR004010 | 683 | 764 | PF02743 | Cache | |
ProfileScan | IPR002035 | 139 | 354 | PS50234 | von Willebrand factor |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1007 | VGPVAGGIMGCIMVLVLAVYAYR | 1029 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TGCCCCACTCCACAAAATAGG |
---|---|
Primer_r | ACCTCTTAAATTCCTCTGCCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | TGCCCCACTCCACAAAATAGG |
Primer_r | ACCTCTTAAATTCCTCTGCCC |
PCR product length | 146 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |