|
Order Kazusa clone(s) from : |
| Product ID | ORK04412 |
|---|---|
| Accession No | AB046793 |
| Description | cache domain containing 1 |
| Clone name | fh23868 |
| Vector information | |
| cDNA sequence | DNA sequence (5050 bp) Predicted protein sequence (1185 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1573
by Kazusa Mouse cDNA Project
|
Length: 5050 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1491 bp |
|---|---|
| Genome contig ID | gi89161185f_64720440 |
| PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (210885 - 210934) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 64820432 | 64931323 | 25 | 99.6 | Perfect prediction |
Length: 1185 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR013608 | 1 | 115 | PF08399 | VWA N-terminal |
| IPR002035 | 139 | 334 | PF00092 | von Willebrand factor | |
| IPR004010 | 364 | 443 | PF02743 | Cache | |
| IPR004010 | 683 | 764 | PF02743 | Cache | |
| ProfileScan | IPR002035 | 139 | 354 | PS50234 | von Willebrand factor |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1007 | VGPVAGGIMGCIMVLVLAVYAYR | 1029 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TGCCCCACTCCACAAAATAGG |
|---|---|
| Primer_r | ACCTCTTAAATTCCTCTGCCC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | CCR |
|---|---|
| Primer_f | TGCCCCACTCCACAAAATAGG |
| Primer_r | ACCTCTTAAATTCCTCTGCCC |
| PCR product length | 146 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |