KIAA1573

Product ID	ORK04412
Accession No	AB046793
Description	cache domain containing 1
Clone name	fh23868
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5050 bp) Predicted protein sequence (1185 aa)
Source	Human fetal brain
Rouge ID	mKIAA1573 by Kazusa Mouse cDNA Project

Length: 5050 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1491 bp
Genome contig ID	gi89161185f_64720440
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATTGCAATCTAGTGAAATAAACTGTATGCAATGG
Flanking genome sequence (210885 - 210934)	----+--------+--------+--------+--------+----* ACCATTTTAGTGGCTACAGTGATTTGTTAATGTACCACTCCTTGTGCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	64820432	64931323	25	99.6	Perfect prediction

Length: 1185 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06551	100.0	cache domain co...	Homo sapiens
CAH70309	99.9	cache domain co...	Homo sapiens
Q5VU97	99.9	VWFA and cache ...	Homo sapiens
XP_001089910	99.6	similar to von ...	Macaca mulatta
XP_536680	98.9	similar to von ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013608	1	115	PF08399	VWA N-terminal
	IPR002035	139	334	PF00092	von Willebrand factor
	IPR004010	364	443	PF02743	Cache
	IPR004010	683	764	PF02743	Cache
ProfileScan	IPR002035	139	354	PS50234	von Willebrand factor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1007	VGPVAGGIMGCIMVLVLAVYAYR	1029	PRIMARY	23

Primer_f	TGCCCCACTCCACAAAATAGG
Primer_r	ACCTCTTAAATTCCTCTGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TGCCCCACTCCACAAAATAGG
Primer_r	ACCTCTTAAATTCCTCTGCCC
PCR product length	146 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles