KIAA1792

Product ID	ORK00920
Accession No	AB058695
Description	FAST kinase domains 5
Clone name	fh27316
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5223 bp) Predicted protein sequence (808 aa)
HaloTag ORF Clone	FHC00920
Flexi ORF Clone	FXC00920
Source	Human fetal brain
Rouge ID	mKIAA1792 by Kazusa Mouse cDNA Project

Length: 5223 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	251 bp
Genome contig ID	gi51511747r_2975171
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AGTAAATAATAAACATCTTAATATGTCCTACGGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTAAGTCCTTGTTGGATTTTTCTTTCTGTTTACCAGCCTTATGTCACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	3075171	3080393	1	99.0	Perfect prediction

Length: 808 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L8L6	100.0	FAST kinase dom...	Homo sapiens
Q5RFI6	95.3	FAST kinase dom...	Pongo abelii
CAH92792	95.0	hypothetical pr...	Pongo abelii
Q95KD0	94.6	FAST kinase dom...	Macaca fascicularis
XP_001915879	82.2	FAST kinase dom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058703	7.2e-08	20.9	KIAA1800

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	474	546	PF06743	FAST kinase leucine-rich
	IPR013579	553	646	PF08368	FAST kinase-like protein
	IPR013584	743	802	PF08373	RAP domain

Primer_f	CTCTCTGAAGGGCATTTAGGG
Primer_r	GCTCTAACCTGCCTTGGATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-