Gene/Protein Characteristic Table for KIAA1800
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04989
Accession No AB058703
Description FAST kinase domains 1
Clone name fj21226
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4156 bp)
Predicted protein sequence (736 aa)
Source Human fetal brain
Rouge ID mKIAA1800 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4156 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1945 bp
Genome contig ID gi89161199r_169992636
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TCCTTTGGATATAAATCATTAAAAATTTAGTCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATACTTGTGGTACATGGAAATCTTGATTGAATAACCCTGGTATACTTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 r 170092636 170133962 13 99.3 Internal No-hit
Features of the protein sequence
Description

Length: 736 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q53R41 0 95.8 FAST kinase dom...
Homo sapiens
EAX11271 0 95.7 hypothetical pr...
Homo sapiens
XP_515885 0 95.2 hypothetical pr...
Pan troglodytes
BAB85043 0 95.5 unnamed protein...
Homo sapiens
EAX11272 0 95.5 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058695 5.6e-08 20.6 KIAA1792
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010622 432 502 PF06743 FAST kinase leucine-rich
IPR013579 516 602 PF08368 FAST kinase-like protein
IPR013584 668 727 PF08373 RAP domain
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGAGTAGTTTTGCCACATCTG
Primer_r AGAAGTGACTCAGGAAACGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp