KIAA1343

Product ID	ORK02028
Accession No	AB037764
Description	REST corepressor 3, transcript variant 4
Clone name	fj00420
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4083 bp) Predicted protein sequence (520 aa)
HaloTag ORF Clone	FHC02028
Flexi ORF Clone	FXC02028
Source	Human fetal brain
Rouge ID	mKIAA1343 by Kazusa Mouse cDNA Project

Length: 4083 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2466 bp
Genome contig ID	gi89161185f_209399949
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AACTAAAAATAAACCACACTGTGGATACATCTTAT
Flanking genome sequence (156253 - 156302)	----+--------+--------+--------+--------+----* AAAACTAATGGAAACAATGTTTTTCTATATGATTTAATTCTAGTGTAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	209499949	209556200	11	99.2	Perfect prediction

Length: 520 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL12969	6.1e-148	95.6	REST corepresso...	Mus musculus
XP_514175	3.3e-147	100.0	REST corepresso...	Pan troglodytes
BAG63899	3.3e-147	100.0	unnamed protein...	Homo sapiens
Q9P2K3	2.8e-146	100.0	REST corepressor 3.	Homo sapiens
XP_001109084	4.7e-146	99.8	similar to REST...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31888	3e-18	64.7	KIAA0071

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	24	86	PF01448	ELM2
	IPR014778	111	156	PF00249	Myb
	IPR014778	312	357	PF00249	Myb
HMMSmart	IPR001005	110	158	SM00717	SANT
HMMSmart	IPR001005	311	359	SM00717	SANT
ProfileScan	IPR000949	24	108	PS51156	ELM2

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	VSLPFSFFSFLFFIYIFWHCFAD	23	PRIMARY	23

Primer_f	ACAGGCGTCGGTTTAACTTAG
Primer_r	TCCTCTTCTTCATCAGTGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-