KIAA1466

Product ID	ORK05662
Accession No	AB040899
Description	Homo sapiens mRNA for KIAA1466 protein, partial cds.
Clone name	fj01441
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4520 bp) Predicted protein sequence (505 aa)
Source	Human fetal brain
Rouge ID	mKIAA1466 by Kazusa Mouse cDNA Project

Length: 4520 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1791 bp
Genome contig ID	gi89161213f_134412983
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GATGTACACCTAAAAATAAAAACTTTCCTGCATCC
Flanking genome sequence (104270 - 104319)	----+--------+--------+--------+--------+----* AATTCTTCGGTCTCTCTTGTCCCTTAATTTTCGCAACATTTCAAGACAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	134512962	134517251	1	99.0	Terminal No-hit

Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAP06677	6.9e-89	48.4	pol protein [Hu...	Human endogenou...
ABC26820	6.3e-78	46.8	polymerase [Ret...	Reticuloendothe...
ACJ65653	6.5e-78	46.8	pol protein [Re...	Reticuloendothe...
ABD46829	6.5e-78	46.8	pol protein [Re...	Reticuloendothe...
ABC26818	1.2e-77	46.5	polymerase [Ret...	Reticuloendothe...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037726	5.1e-06	25.0	KIAA1305
AB067512	0.0006	23.8	KIAA1925

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002156	53	148	PF00075	Ribonuclease H
HMMPfam	IPR001584	272	425	PF00665	Integrase
ProfileScan	IPR002156	13	148	PS50879	Ribonuclease H
ProfileScan	IPR001584	272	428	PS50994	Integrase

Primer_f	ACCAAAGGGGGGAATGAAGTG
Primer_r	GTTAATGTTTCTTGGGACTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ACCAAAGGGGGGAATGAAGTG
Primer_r	GTTAATGTTTCTTGGGACTGG
PCR product length	192 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles