KIAA1373

Gene/Protein Characteristic Table for KIAA1373

Order Kazusa clone(s) from :

Product ID	ORK00221
Accession No	AB037794
Description	STAM binding protein-like 1
Clone name	fj03723
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4052 bp) Predicted protein sequence (463 aa)
HaloTag ORF Clone	FHC00221
Flexi ORF Clone	FXC00221
Source	Human fetal brain

Length: 4052 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1840 bp
Genome contig ID	gi89161187f_90529603
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGTGAAAGTGAAACCAGAATGCTGTCAACGATT
Flanking genome sequence (195289 - 195338)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACTCTCAAGCAAGAGCAAACAATGATACTGCCTCTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	90629603	90724890	11	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 463 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI13862	6.4e-177	100.0	novel Mov34/MPN...	Homo sapiens
XP_001140148	1.1e-176	99.8	associated mole...	Pan troglodytes
XP_001083976	2.7e-172	97.8	similar to asso...	Macaca mulatta
Q96FJ0	1.5e-160	99.8	AMSH-like prote...	Homo sapiens
XP_001140564	2.5e-160	99.5	associated mole...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000555	266	375	PF01398	Mov34/MPN/PAD-1
HMMSmart	IPR000555	270	396	SM00232	Mov34/MPN/PAD-1

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CGGTGAAATTGATGGTGGAGC
Primer_r	GCAGAAAAAGCTCGCAGGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CGGTGAAATTGATGGTGGAGC
Primer_r	GCAGAAAAAGCTCGCAGGTGG
PCR product length	159 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp