Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00249 |
---|---|
Accession No | AB046802 |
Description | trinucleotide repeat containing 6C, transcript variant 2 |
Clone name | fj05982s1 |
Vector information | |
cDNA sequence | DNA sequence (5318 bp) Predicted protein sequence (1740 aa) |
HaloTag ORF Clone |
FHC00249
|
Flexi ORF Clone | FXC00249 |
Source | Human fetal brain |
Rouge ID |
mKIAA1582
by Kazusa Mouse cDNA Project
|
Note | We replaced fj05982, former representative clones for KIAA1582 with fj05982s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 95 bp |
---|---|
Genome contig ID | gi51511734f_73456589 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (156029 - 156078) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 73556589 | 73612616 | 18 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000449 | 989 | 1028 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR000504 | 1566 | 1631 | PF00076 | RNA recognition motif | |
HMMSmart | IPR000449 | 990 | 1027 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
ProfileScan | IPR000449 | 983 | 1028 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
RT-PCR-ELISA |
Primer_f | CTGCTGGAAAAGAAGGTGGAC |
---|---|
Primer_r | GAAGGCAAGAACGGTGAAGGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | CTGCTGGTCCTGGAATACTCG |
Primer_r | CCTTTCCCATTGATGTCACTG |
PCR product length | 169 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |