Order Kazusa clone(s) from : ![]() |
Product ID | ORK00249 |
---|---|
Accession No | AB046802 |
Description | trinucleotide repeat containing 6C, transcript variant 2 |
Clone name | fj05982s1 |
Vector information | |
cDNA sequence | DNA sequence (5318 bp) Predicted protein sequence (1740 aa) |
HaloTag ORF Clone |
FHC00249
![]() |
Flexi ORF Clone | FXC00249 |
Source | Human fetal brain |
Rouge ID |
mKIAA1582
by Kazusa Mouse cDNA Project
|
Note | We replaced fj05982, former representative clones for KIAA1582 with fj05982s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 95 bp |
---|---|
Genome contig ID | gi51511734f_73456589 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (156029 - 156078) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 73556589 | 73612616 | 18 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000449 | 989 | 1028 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR000504 | 1566 | 1631 | PF00076 | RNA recognition motif | |
HMMSmart | IPR000449 | 990 | 1027 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
ProfileScan | IPR000449 | 983 | 1028 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
![]() |
Primer_f | CTGCTGGAAAAGAAGGTGGAC |
---|---|
Primer_r | GAAGGCAAGAACGGTGAAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CTGCTGGTCCTGGAATACTCG |
Primer_r | CCTTTCCCATTGATGTCACTG |
PCR product length | 169 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |