KIAA1385

Product ID	ORK00225
Accession No	AB037806
Description	gephyrin, transcript variant 2
Clone name	fj06168
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4193 bp) Predicted protein sequence (768 aa)
HaloTag ORF Clone	FHC00225
Flexi ORF Clone	FXC00225
Source	Human fetal brain
Rouge ID	mKIAA1385 by Kazusa Mouse cDNA Project

Length: 4193 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	861 bp
Genome contig ID	gi51511730f_65943878
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACTTAATGAATAAAAAAATTCCTTGATCATTATTT
Flanking genome sequence (774392 - 774441)	----+--------+--------+--------+--------+----* AAAAATGTAATGTGTTGGCCTCGTTATTTAAAGAGAGAAGATTGTCATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	66043878	66718268	20	99.7	Internal No-hit

Length: 768 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NQX3	100.0	Gephyrin.	Homo sapiens
CAA47009	99.9	Gephyrin [Rattu...	Rattus norvegicus
CAC81240	99.9	gephyrin [Homo ...	Homo sapiens
EDM03692	99.7	rCG61772, isofo...	Rattus norvegicus
Q9PW38	98.5	Gephyrin.	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001453	539	680	PD002460	Molybdopterin binding domain
HMMPfam	IPR001453	50	196	PF00994	Molybdopterin binding domain
	IPR005110	355	521	PF03453	MoeA
	IPR001453	534	677	PF00994	Molybdopterin binding domain
	IPR005111	690	766	PF03454	MoeA
HMMTigr	IPR001453	46	192	TIGR00177	Molybdopterin binding domain
HMMTigr	IPR001453	530	673	TIGR00177	Molybdopterin binding domain
ScanRegExp	IPR008284	113	126	PS01078	Molybdenum cofactor biosynthesis protein
ScanRegExp	IPR008284	607	642	PS01079	Molybdenum cofactor biosynthesis protein

Primer_f	TCAAAGCAAGGTTATCATGTG
Primer_r	GTACTGTTCTGTCTTTGGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-