Order Kazusa clone(s) from : ![]() |
Product ID | ORK00225 |
---|---|
Accession No | AB037806 |
Description | gephyrin, transcript variant 2 |
Clone name | fj06168 |
Vector information | |
cDNA sequence | DNA sequence (4193 bp) Predicted protein sequence (768 aa) |
HaloTag ORF Clone |
FHC00225
![]() |
Flexi ORF Clone | FXC00225 |
Source | Human fetal brain |
Rouge ID |
mKIAA1385
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 861 bp |
---|---|
Genome contig ID | gi51511730f_65943878 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (774392 - 774441) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 66043878 | 66718268 | 20 | 99.7 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001453 | 539 | 680 | PD002460 | Molybdopterin binding domain |
HMMPfam | IPR001453 | 50 | 196 | PF00994 | Molybdopterin binding domain |
IPR005110 | 355 | 521 | PF03453 | MoeA | |
IPR001453 | 534 | 677 | PF00994 | Molybdopterin binding domain | |
IPR005111 | 690 | 766 | PF03454 | MoeA | |
HMMTigr | IPR001453 | 46 | 192 | TIGR00177 | Molybdopterin binding domain |
IPR001453 | 530 | 673 | TIGR00177 | Molybdopterin binding domain | |
ScanRegExp | IPR008284 | 113 | 126 | PS01078 | Molybdenum cofactor biosynthesis protein |
IPR008284 | 607 | 642 | PS01079 | Molybdenum cofactor biosynthesis protein |
![]() |
Primer_f | TCAAAGCAAGGTTATCATGTG |
---|---|
Primer_r | GTACTGTTCTGTCTTTGGAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |