KIAA1208

Product ID	ORK05322
Accession No	AB033034
Description	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Clone name	fj07955
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4511 bp) Predicted protein sequence (950 aa)
Source	Human fetal brain
Rouge ID	mKIAA1208 by Kazusa Mouse cDNA Project
Note	We replaced fg05318, former representative clones for KIAA1208 with fj07955. (2002/5/10)

Length: 4511 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1657 bp
Genome contig ID	gi89161190r_100563415
PolyA signal sequence (CATAAA,-18)	+--------+--------+----*----+---- TTCAAAAACTGAAATCTCATAAAAAGTTAAATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTCTGACACTTTGATTTTTAAATCTTTGAGGATTGAGTTTACTGTTACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	100663415	100688500	13	99.5	Terminal No-hit

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3T906	100.0	N-acetylglucosa...	Homo sapiens
AAV98624	99.8	GlcNAc-phosphot...	Homo sapiens
XP_001155334	99.5	N-acetylglucosa...	Pan troglodytes
EAW97684	98.8	N-acetylglucosa...	Homo sapiens
XP_001092998	97.6	similar to N-ac...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000800	127	163	PF00066	Notch region
HMMPfam	IPR010506	393	508	PF06464	DMAP1-binding
HMMSmart	IPR000800	125	163	SM00004	Notch region
HMMSmart	IPR000800	192	230	SM00004	Notch region
ProfileScan	IPR000800	132	167	PS50258	Notch region
	IPR000800	199	239	PS50258	Notch region
	IPR002048	699	734	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	712	724	PS00018	Calcium-binding EF-hand

Primer_f	TAGGCGTTACTGAAGTGTTAC
Primer_r	TTGCTATCAGTGAAGTATGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-