Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00872 |
---|---|
Accession No | AB046807 |
Description | melanoma antigen family E1 |
Clone name | fj08327 |
Vector information | |
cDNA sequence | DNA sequence (3628 bp) Predicted protein sequence (991 aa) |
HaloTag ORF Clone |
FHC00872
|
Flexi ORF Clone | FXC00872 |
Source | Human fetal brain |
Rouge ID |
mKIAA1587
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 547 bp |
---|---|
Genome contig ID | gi89161218f_75464521 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (103629 - 103678) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 198 | 324 | PD041608 | NULL |
IPR008165 | 325 | 423 | PD003992 | Protein of unknown function GLTT | |
NULL | 424 | 471 | PD041608 | NULL | |
HMMPfam | IPR002190 | 532 | 702 | PF01454 | MAGE protein |
IPR002190 | 786 | 948 | PF01454 | MAGE protein | |
ProfileScan | IPR002190 | 525 | 724 | PS50838 | MAGE protein |
IPR002190 | 779 | 970 | PS50838 | MAGE protein |
RT-PCR-ELISA |
Primer_f | GTTTACGGGTTCCTGACAGTG |
---|---|
Primer_r | AACATCAGCTCTATTGGCCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |