KIAA1599

Product ID	ORK00874
Accession No	AB046819
Description	copine V
Clone name	fj09928
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3897 bp) Predicted protein sequence (608 aa)
HaloTag ORF Clone	FHC00874
Flexi ORF Clone	FXC00874
Source	Human fetal brain

Length: 3897 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1490 bp
Genome contig ID	gi89161210r_36716533
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TTGCCTTAAACTGAAGTAAATTTGGTTCTTTTAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCACGAAGTTTTTCTTTCTTCTCTGAAAAATAGCACTGACGTTGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	36816533	36915756	21	99.4	Perfect prediction

Length: 608 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCH3	100.0	Copine-5; Copine V.	Homo sapiens
XP_538889	98.5	similar to Copi...	Canis lupus fam...
XP_585264	98.3	similar to Copi...	Bos taurus
Q8JZW4	98.0	Copine-5; Copine V.	Mus musculus
EDL96957	97.8	copine V (predi...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014536	3.6e-59	52.1	KIAA0636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	208	220	PR00360	C2 calcium-dependent membrane targeting
FPrintScan	IPR000008	263	271	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	44	131	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	198	283	PF00168	C2 calcium-dependent membrane targeting
	IPR010734	362	506	PF07002	Copine
HMMSmart	IPR000008	38	146	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	176	298	SM00239	C2 calcium-dependent membrane targeting
	IPR002035	341	534	SM00327	von Willebrand factor
ProfileScan	IPR000008	44	131	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	162	283	PS50004	C2 calcium-dependent membrane targeting
	IPR002035	343	569	PS50234	von Willebrand factor

Primer_f	AGGGACCCAGATCAACTTCAC
Primer_r	CTGTCGTAGTGCTGGATGATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-