KIAA1617

Product ID	ORK00880
Accession No	AB046837
Description	Scm-like with four mbt domains 2, transcript variant 2
Clone name	fj13890
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4259 bp) Predicted protein sequence (904 aa)
HaloTag ORF Clone	FHC00880
Flexi ORF Clone	FXC00880
Source	Human fetal brain
Rouge ID	mKIAA1617 by Kazusa Mouse cDNA Project

Length: 4259 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1483 bp
Genome contig ID	gi89161187r_7144255
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCACTCATGCTGGAAAGGAAGATCCAGATCGTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTAGAAAAAGAAAGAATAAGAAGGGTCTGGTCCCAGTTCTGACTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	7244255	7491309	21	99.6	Perfect prediction

Length: 904 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VUG0	100.0	Scm-like with f...	Homo sapiens
XP_001118715	97.9	Scm-like with f...	Macaca mulatta
XP_850333	92.1	similar to Scm-...	Canis lupus fam...
XP_001500014	91.8	similar to Scm-...	Equus caballus
XP_607062	90.9	similar to Scm-...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014581	1e-14	31.5	KIAA0681
AB058701	4.8e-11	29.7	KIAA1798

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004092	88	163	PF02820	Mbt repeat
	IPR004092	203	270	PF02820	Mbt repeat
	IPR004092	314	391	PF02820	Mbt repeat
	IPR004092	422	492	PF02820	Mbt repeat
	IPR011510	831	897	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR004092	54	154	SM00561	Mbt repeat
	IPR004092	162	266	SM00561	Mbt repeat
	IPR004092	276	382	SM00561	Mbt repeat
	IPR004092	390	487	SM00561	Mbt repeat
	IPR001660	831	897	SM00454	Sterile alpha motif SAM
ProfileScan	IPR004092	54	154	PS51079	Mbt repeat
	IPR004092	162	266	PS51079	Mbt repeat
	IPR004092	276	382	PS51079	Mbt repeat
	IPR004092	390	487	PS51079	Mbt repeat

Primer_f	AGATCGAGAGAGTCAAAGTGG
Primer_r	ACATGGAAACAGCTCACAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AGATCGAGAGAGTCAAAGTGG
Primer_r	ACATGGAAACAGCTCACAGGC
PCR product length	219 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles