Order Kazusa clone(s) from : ![]() |
Product ID | ORK05796 |
---|---|
Accession No | AB014581 |
Description | l(3)mbt-like 1 (Drosophila) |
Clone name | hk02748 |
Vector information | |
cDNA sequence | DNA sequence (4323 bp) Predicted protein sequence (538 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0681
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004092 | 28 | 101 | PF02820 | Mbt repeat |
IPR004092 | 135 | 208 | PF02820 | Mbt repeat | |
IPR004092 | 239 | 312 | PF02820 | Mbt repeat | |
IPR002515 | 337 | 367 | PF01530 | Zinc finger | |
IPR001660 | 467 | 531 | PF00536 | Sterile alpha motif SAM | |
HMMSmart | IPR004092 | 1 | 92 | SM00561 | Mbt repeat |
IPR004092 | 100 | 199 | SM00561 | Mbt repeat | |
IPR004092 | 208 | 303 | SM00561 | Mbt repeat | |
IPR001660 | 466 | 533 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR004092 | 1 | 92 | PS51079 | Mbt repeat |
IPR004092 | 100 | 199 | PS51079 | Mbt repeat | |
IPR004092 | 208 | 303 | PS51079 | Mbt repeat | |
IPR001660 | 469 | 533 | PS50105 | Sterile alpha motif SAM |
![]() |
---|
![]() |
Primer_f | TGTGGTGAAGGCAAGATGGAC |
---|---|
Primer_r | TATCATTTGGGGACAGAGTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGTGGTGAAGGCAAGATGGAC |
Primer_r | TATCATTTGGGGACAGAGTGG |
PCR product length | 185 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |