Gene/Protein Characteristic Table for KIAA0681
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05796
Accession No AB014581
Description l(3)mbt-like 1 (Drosophila)
Clone name hk02748
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4323 bp)
Predicted protein sequence (538 aa)
Source Human adult brain
Rouge ID mKIAA0681 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4323 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 538 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_525331 0 100.0 l(3)mbt-like is...
Pan troglodytes
XP_534423 0 96.5 similar to l(3)...
Canis lupus fam...
XP_001787433 3.3e-216 95.7 L(3)malignant b...
Bos taurus
XP_001500403 3.2e-211 94.2 similar to l(3)...
Equus caballus
XP_230849 1.1e-209 92.2 similar to Leth...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058701 7.2e-92 54.2 KIAA1798
AB046837 2.6e-16 31.1 KIAA1617
AB029029 4.2e-05 36.5 KIAA1106
AB028973 0.00025 27.1 KIAA1050
AB011107 0.00025 25.2 KIAA0535
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004092 28 101 PF02820 Mbt repeat
IPR004092 135 208 PF02820 Mbt repeat
IPR004092 239 312 PF02820 Mbt repeat
IPR002515 337 367 PF01530 Zinc finger
IPR001660 467 531 PF00536 Sterile alpha motif SAM
HMMSmart IPR004092 1 92 SM00561 Mbt repeat
IPR004092 100 199 SM00561 Mbt repeat
IPR004092 208 303 SM00561 Mbt repeat
IPR001660 466 533 SM00454 Sterile alpha motif SAM
ProfileScan IPR004092 1 92 PS51079 Mbt repeat
IPR004092 100 199 PS51079 Mbt repeat
IPR004092 208 303 PS51079 Mbt repeat
IPR001660 469 533 PS50105 Sterile alpha motif SAM
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f TGTGGTGAAGGCAAGATGGAC
Primer_r TATCATTTGGGGACAGAGTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 20
Experimental conditions
Panel name GeneBridge 4
Primer_f TGTGGTGAAGGCAAGATGGAC
Primer_r TATCATTTGGGGACAGAGTGG
PCR product length 185 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp