KIAA1697

Product ID	ORK04799
Accession No	AB051484
Description	dynein, axonemal, heavy chain 6
Clone name	fj14406y2
Vector information	The cDNA fragment was inserted at ApaI-NotI site of the pBlu ... The cDNA fragment was inserted at ApaI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CG-5' end of cDNA
cDNA sequence	DNA sequence (6721 bp) Predicted protein sequence (2182 aa)
Source	Human fetal brain
Rouge ID	mKIAA1697 by Kazusa Mouse cDNA Project
Note	We replaced fj14406, former representative clones for KIAA1697 with fj14406y2. (2005/08/06)

Length: 6721 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	172 bp
Genome contig ID	gi89161199f_84639660
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTATGACCTTAAAATAAAGTGTTTGAGTTCTTTC
Flanking genome sequence (260557 - 260606)	----+--------+--------+--------+--------+----* TGTTGGCAATCCAAGCTCTGCTGTAGAAGCAGTGGGTTCAACAACCCACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	84739654	84900215	41	99.9	Terminal No-hit

Length: 2182 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06719	100.0	DNAH6 variant p...	Homo sapiens
Q9C0G6	100.0	Dynein heavy ch...	Homo sapiens
XP_515578	98.8	similar to SI:z...	Pan troglodytes
XP_001082827	98.2	similar to Dyne...	Macaca mulatta
XP_001916921	93.6	similar to Dyne...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	1.2e-191	40.2	KIAA1503
AB095937	3e-164	34.4	KIAA2017
AB002355	4.7e-152	32.4	KIAA0357
AB023161	8.4e-88	41.7	KIAA0944
AB037831	7e-86	41.5	KIAA1410

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011704	115	262	PF07728	ATPase associated with various cellular activities
HMMPfam	IPR004273	1512	2179	PF03028	Dynein heavy chain
HMMSmart	IPR003593	112	265	SM00382	AAA+ ATPase
HMMSmart	IPR003593	463	621	SM00382	AAA+ ATPase

Primer_f	TATTTTGCACCCATGGCTGAC
Primer_r	GTAGATGACCTTGGCTGAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TATTTTGCACCCATGGCTGAC
Primer_r	GTAGATGACCTTGGCTGAACC
PCR product length	176 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles