KIAA1525

Product ID	ORK01173
Accession No	AB040958
Description	BTB (POZ) domain containing 7, transcript variant 1
Clone name	fj15588
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4818 bp) Predicted protein sequence (1135 aa)
HaloTag ORF Clone	FHC01173
Flexi ORF Clone	FXC01173
Source	Human fetal brain
Rouge ID	mKIAA1525 by Kazusa Mouse cDNA Project
Note	We replaced fj01939, former representative clones for KIAA1525 with fj15588. (2001/2/22)

Length: 4818 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1111 bp
Genome contig ID	gi51511730r_92677550
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGCTCCCACCTGGGCAACAGTGAGACCCTGTCTC
Flanking genome sequence (99713 - 99664)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGGCAGTGGAAATAGAGAAGTAACTTAAAGGTCACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	92777263	92869120	11	99.6	Perfect prediction

Length: 1135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P203	100.0	BTB/POZ domain-...	Homo sapiens
XP_001150552	99.6	BTB (POZ) domai...	Pan troglodytes
XP_547956	96.5	similar to BTB ...	Canis lupus fam...
XP_001927139	96.0	BTB (POZ) domai...	Sus scrofa
XP_001497701	94.9	BTB (POZ) domai...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	135	241	PF00651	BTB/POZ
	IPR013069	243	400	PF00651	BTB/POZ
	IPR011705	421	481	PF07707	BTB/Kelch-associated
HMMSmart	IPR000210	145	247	SM00225	BTB/POZ-like
HMMSmart	IPR000210	250	400	SM00225	BTB/POZ-like
ProfileScan	IPR000210	145	214	PS50097	BTB/POZ-like
ProfileScan	IPR000210	250	344	PS50097	BTB/POZ-like

Primer_f	CTTAAAGTCAGCCTACCTACC
Primer_r	TTGCTCAACGACATCCAGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-