Order Kazusa clone(s) from : ![]() |
Product ID | ORK01173 |
---|---|
Accession No | AB040958 |
Description | BTB (POZ) domain containing 7, transcript variant 1 |
Clone name | fj15588 |
Vector information | |
cDNA sequence | DNA sequence (4818 bp) Predicted protein sequence (1135 aa) |
HaloTag ORF Clone |
FHC01173
![]() |
Flexi ORF Clone | FXC01173 |
Source | Human fetal brain |
Rouge ID |
mKIAA1525
by Kazusa Mouse cDNA Project
|
Note | We replaced fj01939, former representative clones for KIAA1525 with fj15588. (2001/2/22) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1111 bp |
---|---|
Genome contig ID | gi51511730r_92677550 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99713 - 99664) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 92777263 | 92869120 | 11 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 135 | 241 | PF00651 | BTB/POZ |
IPR013069 | 243 | 400 | PF00651 | BTB/POZ | |
IPR011705 | 421 | 481 | PF07707 | BTB/Kelch-associated | |
HMMSmart | IPR000210 | 145 | 247 | SM00225 | BTB/POZ-like |
IPR000210 | 250 | 400 | SM00225 | BTB/POZ-like | |
ProfileScan | IPR000210 | 145 | 214 | PS50097 | BTB/POZ-like |
IPR000210 | 250 | 344 | PS50097 | BTB/POZ-like |
Primer_f | CTTAAAGTCAGCCTACCTACC |
---|---|
Primer_r | TTGCTCAACGACATCCAGGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |