KIAA1708

Product ID	ORK00269
Accession No	AB051495
Description	kinesin family member 21A, transcript variant 2
Clone name	fj17878y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone has an irregular adaptor sequence (GTCGACCCAC GCGTCCGTAA TACGACTCAC TATAGGGCGA ATTGGGTACC GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGTAATACGA CTCACTATAG GGCGAATTGG GTACCGGGCC CCCCCTCGAG GTCGACCCAC GCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6170 bp) Predicted protein sequence (1657 aa)
HaloTag ORF Clone	FHC00269
Flexi ORF Clone	FXC00269
Source	Human fetal brain
Rouge ID	mKIAA1708 by Kazusa Mouse cDNA Project
Note	We replaced fj17878, former representative clones for KIAA1708 with fj17878y1. (2003/4/2)

Length: 6170 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1195 bp
Genome contig ID	gi89161190r_37873298
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGCTAGGGCTTAAATAAACATGTTGCTATGAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTACTGTATTGTTCTTTTTCCAAATTGCAAGAGAATGGCCAGTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	37973298	38123028	36	99.8	Perfect prediction

Length: 1657 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW57803	100.0	kinesin family ...	Homo sapiens
AAP97680	99.2	kinesin-like pr...	Homo sapiens
XP_868987	95.7	kinesin family ...	Bos taurus
EAW57804	99.8	kinesin family ...	Homo sapiens
EAW57802	96.3	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007918	2.6e-101	60.1	KIAA0449
AB002357	3.9e-09	32.1	KIAA0359
AB011103	1.2e-08	27.7	KIAA0531
AB037826	4e-08	28.2	KIAA1405
AB040881	1.8e-06	26.3	KIAA1448

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	75	96	PR00380	Kinesin
	IPR001752	213	230	PR00380	Kinesin
	IPR001752	317	338	PR00380	Kinesin
	IPR001680	1343	1357	PR00320	WD40 repeat
	IPR001680	1539	1553	PR00320	WD40 repeat
	IPR001680	1622	1636	PR00320	WD40 repeat
HMMPfam	IPR001752	11	368	PF00225	Kinesin
	IPR001680	1320	1356	PF00400	WD40 repeat
	IPR001680	1360	1397	PF00400	WD40 repeat
	IPR001680	1424	1461	PF00400	WD40 repeat
	IPR001680	1465	1506	PF00400	WD40 repeat
	IPR001680	1515	1552	PF00400	WD40 repeat
	IPR001680	1557	1595	PF00400	WD40 repeat
	IPR001680	1599	1635	PF00400	WD40 repeat
HMMSmart	IPR001752	3	375	SM00129	Kinesin
	IPR001680	1319	1356	SM00320	WD40 repeat
	IPR001680	1359	1397	SM00320	WD40 repeat
	IPR001680	1423	1461	SM00320	WD40 repeat
	IPR001680	1464	1506	SM00320	WD40 repeat
	IPR001680	1514	1552	SM00320	WD40 repeat
	IPR001680	1555	1595	SM00320	WD40 repeat
	IPR001680	1598	1635	SM00320	WD40 repeat
ProfileScan	IPR001752	2	295	PS50067	Kinesin
	IPR001680	1326	1365	PS50082	WD40 repeat
	IPR001680	1326	1644	PS50294	WD40 repeat
	IPR001680	1522	1561	PS50082	WD40 repeat
	IPR001680	1563	1598	PS50082	WD40 repeat
	IPR001680	1605	1638	PS50082	WD40 repeat
ScanRegExp	IPR001752	264	275	PS00411	Kinesin
ScanRegExp	IPR001680	1343	1357	PS00678	WD40 repeat

Primer_f	AGAGGGGGCATTTTGAAAGTC
Primer_r	CTTCCAAATTCTCACAGTTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-