Gene/Protein Characteristic Table for KIAA1710
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01633
Accession No AB051497
Description zinc finger protein 436, transcript variant 2
Clone name fj18457
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4071 bp)
Predicted protein sequence (515 aa)
Flexi ORF Clone FXC01633
Source Human fetal brain
Rouge ID mKIAA1710 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4071 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2521 bp
Genome contig ID gi89161185r_23458529
PolyA signal sequence
(ATTAAA,-24)		 
+----*----+----*----+----*----+----
AATATTCTATAATTAAAAATATAATTTTTAAAGTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGCAAACCTGAGAATTATTTTAGTAACCCAGCACTGATTCATTTAATGGC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 r 23558529 23568522 4 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 515 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9C0F3 7.2e-198 100.0 Zinc finger pro...
 Homo sapiens
XP_001165342 7e-197 99.6 zinc finger pro...
 Pan troglodytes
Q5R5Y7 1.1e-196 99.6 Zinc finger pro...
 Pongo abelii
XP_001102479 8.9e-196 99.4 zinc finger pro...
 Macaca mulatta
XP_001504280 3.6e-194 98.1 zinc finger pro...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058755 6.4e-71 59.8 KIAA1852
AB075836 7.4e-71 54.1 KIAA1956
AB040941 1.3e-70 58.7 KIAA1508
AB002324 1.6e-69 57.5 KIAA0326
AB046831 6.5e-69 60.2 KIAA1611
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 183 206 PD000003 Zinc finger
IPR007087 211 234 PD000003 Zinc finger
IPR007087 239 262 PD000003 Zinc finger
IPR007087 267 290 PD000003 Zinc finger
IPR007087 295 318 PD000003 Zinc finger
IPR007087 323 346 PD000003 Zinc finger
IPR007087 351 374 PD000003 Zinc finger
IPR007087 379 402 PD000003 Zinc finger
IPR007087 407 430 PD000003 Zinc finger
IPR007087 435 458 PD000003 Zinc finger
IPR007087 463 486 PD000003 Zinc finger
IPR007087 491 514 PD000003 Zinc finger
HMMPfam IPR001909 59 99 PF01352 KRAB box
IPR007087 183 205 PF00096 Zinc finger
IPR007087 211 233 PF00096 Zinc finger
IPR007087 239 261 PF00096 Zinc finger
IPR007087 267 289 PF00096 Zinc finger
IPR007087 295 317 PF00096 Zinc finger
IPR007087 323 345 PF00096 Zinc finger
IPR007087 351 373 PF00096 Zinc finger
IPR007087 379 401 PF00096 Zinc finger
IPR007087 407 429 PF00096 Zinc finger
IPR007087 435 457 PF00096 Zinc finger
IPR007087 463 485 PF00096 Zinc finger
IPR007087 491 513 PF00096 Zinc finger
HMMSmart IPR001909 59 120 SM00349 KRAB box
IPR015880 183 205 SM00355 Zinc finger
IPR015880 211 233 SM00355 Zinc finger
IPR015880 239 261 SM00355 Zinc finger
IPR015880 267 289 SM00355 Zinc finger
IPR015880 295 317 SM00355 Zinc finger
IPR015880 323 345 SM00355 Zinc finger
IPR015880 351 373 SM00355 Zinc finger
IPR015880 379 401 SM00355 Zinc finger
IPR015880 407 429 SM00355 Zinc finger
IPR015880 435 457 SM00355 Zinc finger
IPR015880 463 485 SM00355 Zinc finger
IPR015880 491 513 SM00355 Zinc finger
ProfileScan IPR001909 59 131 PS50805 KRAB box
IPR007087 183 210 PS50157 Zinc finger
IPR007087 211 238 PS50157 Zinc finger
IPR007087 239 266 PS50157 Zinc finger
IPR007087 267 294 PS50157 Zinc finger
IPR007087 295 322 PS50157 Zinc finger
IPR007087 323 350 PS50157 Zinc finger
IPR007087 351 378 PS50157 Zinc finger
IPR007087 379 406 PS50157 Zinc finger
IPR007087 407 434 PS50157 Zinc finger
IPR007087 435 462 PS50157 Zinc finger
IPR007087 463 490 PS50157 Zinc finger
IPR007087 491 515 PS50157 Zinc finger
ScanRegExp IPR007087 185 205 PS00028 Zinc finger
IPR007087 213 233 PS00028 Zinc finger
IPR007087 241 261 PS00028 Zinc finger
IPR007087 269 289 PS00028 Zinc finger
IPR007087 297 317 PS00028 Zinc finger
IPR007087 325 345 PS00028 Zinc finger
IPR007087 353 373 PS00028 Zinc finger
IPR007087 381 401 PS00028 Zinc finger
IPR007087 409 429 PS00028 Zinc finger
IPR007087 437 457 PS00028 Zinc finger
IPR007087 465 485 PS00028 Zinc finger
IPR007087 493 513 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGAACTCATGCATCAGACTCC
Primer_r AGGATAACTGTGACCAATACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name CCR
Primer_f AGAACTCATGCATCAGACTCC
Primer_r AGGATAACTGTGACCAATACC
PCR product length 179 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp