KIAA1798

Product ID	ORK00921
Accession No	AB058701
Description	l(3)mbt-like 3 (Drosophila), transcript variant 1
Clone name	fj20547
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4101 bp) Predicted protein sequence (781 aa)
HaloTag ORF Clone	FHC00921
Flexi ORF Clone	FXC00921
Source	Human fetal brain
Rouge ID	mKIAA1798 by Kazusa Mouse cDNA Project

Length: 4101 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1684 bp
Genome contig ID	gi89161210f_130285085
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TATATCTGACATGAATGAAATAAAATCTTAATTAC
Flanking genome sequence (219192 - 219241)	----+--------+--------+--------+--------+----* AGATGCTTTTTACATATGTATGATTTTTAAGAAAGCTTCTCAAATAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	130385085	130504275	22	99.9	Perfect prediction

Length: 781 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10151	100.0	lethal(3)malign...	synthetic construct
Q96JM7	99.9	Lethal(3)malign...	Homo sapiens
XP_518737	99.9	l(3)mbt-like 3 ...	Pan troglodytes
XP_001504317	96.8	l(3)mbt-like 3 ...	Equus caballus
XP_001104756	96.9	similar to l(3)...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014581	1.6e-81	54.2	KIAA0681
AB046837	1.1e-10	29.7	KIAA1617

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004092	269	342	PF02820	Mbt repeat
	IPR004092	376	449	PF02820	Mbt repeat
	IPR004092	480	546	PF02820	Mbt repeat
	IPR001660	707	771	PF00536	Sterile alpha motif SAM
HMMSmart	IPR004092	233	333	SM00561	Mbt repeat
	IPR004092	341	440	SM00561	Mbt repeat
	IPR004092	449	544	SM00561	Mbt repeat
	IPR001660	706	773	SM00454	Sterile alpha motif SAM
ProfileScan	IPR004092	233	333	PS51079	Mbt repeat
	IPR004092	341	440	PS51079	Mbt repeat
	IPR004092	449	544	PS51079	Mbt repeat
	IPR001660	709	773	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR000886	778	781	PS00014	Endoplasmic reticulum targeting sequence

Primer_f	CTGTCTGAATTCTGGGGTAAG
Primer_r	GCAAATAAATGACTGGGACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-