KIAA1801

Product ID	ORK05883
Accession No	AB058704
Description	leucine-rich repeats and IQ motif containing 1
Clone name	fj21373
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4021 bp) Predicted protein sequence (1227 aa)
Source	Human fetal brain

Length: 4021 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	335 bp
Genome contig ID	gi89161190f_83863943
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCACAGTCTAAAAATAATAAAAACATTTTCTGAGT
Flanking genome sequence (178826 - 178875)	----+--------+--------+--------+--------+----* AATCAAGTATTTTCATTTTTTAAAAATATACCTTTGCAGGCTGGGCGCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	83963938	84042767	13	99.4	Terminal No-hit

Length: 1227 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JM4	0	99.9	Leucine-rich re...	Homo sapiens
EAW97395	0	99.8	leucine-rich re...	Homo sapiens
NP_001073379	0	99.8	leucine-rich re...	Homo sapiens
EAW97396	0	97.9	leucine-rich re...	Homo sapiens
XP_001478078	2.9e-181	54.9	eucine-rich rep...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	884	897	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	971	984	PR00019	Leucine-rich repeat
HMMPfam	IPR000048	175	195	PF00612	IQ calmodulin-binding region
	IPR001611	710	730	PF00560	Leucine-rich repeat
	IPR001611	883	903	PF00560	Leucine-rich repeat
	IPR001611	905	925	PF00560	Leucine-rich repeat
	IPR001611	927	947	PF00560	Leucine-rich repeat
	IPR001611	973	997	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	751	773	SM00369	Leucine-rich repeat
	IPR003591	859	881	SM00369	Leucine-rich repeat
	IPR003591	925	946	SM00369	Leucine-rich repeat
	IPR003591	971	994	SM00369	Leucine-rich repeat
ProfileScan	IPR000048	174	203	PS50096	IQ calmodulin-binding region

Primer_f	TCTTCTACTCTTGTGCACGTG
Primer_r	GGAATACTGCTTGCCTTGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-