KIAA1649

Product ID	ORK00261
Accession No	AB055760
Description	polymerase (DNA-directed), delta interacting protein 3, transcript variant 1
Clone name	fk12339
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3345 bp) Predicted protein sequence (424 aa)
HaloTag ORF Clone	FHC00261
Flexi ORF Clone	FXC00261
Source	Human fetal brain
Rouge ID	mKIAA1649 by Kazusa Mouse cDNA Project
Note	We replaced hh04042, former representative clones for KIAA1649 with fk12339. (2003/8/28)

Length: 3345 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2069 bp
Genome contig ID	gi89161203r_41209672
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTTATCCATTTCTGAATAAACATTTGTTATTCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTTGAGTTATCTTTTTTTTTTTTTTTTTTTTTTTTTTGAGACAAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	41309672	41340817	9	100.0	Perfect prediction

Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW73266	1.2e-161	100.0	polymerase (DNA...	Homo sapiens
Q9BY77	1.4e-160	100.0	Polymerase delt...	Homo sapiens
XP_001103556	7.2e-160	98.6	similar to DNA ...	Macaca mulatta
AAH01488	5e-159	100.0	POLDIP3 protein...	Homo sapiens
AAI34442	8.4e-153	94.8	Polymerase (DNA...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	285	349	PF00076	RNA recognition motif
HMMSmart	IPR000504	284	350	SM00360	RNA recognition motif
ProfileScan	IPR000504	283	354	PS50102	RNA recognition motif

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-