KIAA0029

Product ID	ORK00005
Accession No	D21852
Description	R3H domain containing 1, transcript variant 3
Clone name	ha00566
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4272 bp) Predicted protein sequence (974 aa)
HaloTag ORF Clone	FHC00005
Flexi ORF Clone	FXC00005
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0029 by Kazusa Mouse cDNA Project

Length: 4272 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	974 bp
Genome contig ID	gi89161199f_135905541
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCTTTTTCAGTTCAAGAGAATAAATGTTTACAAAT
Flanking genome sequence (293767 - 293816)	----+--------+--------+--------+--------+----* ATAGGCTCACTTTGTCTTTTTTTTAATTAAAAACACCTTTTAAATGAGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	136005541	136199306	23	100.0	Perfect prediction

Length: 974 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11123	100.0	R3H domain-cont...	synthetic construct
EAX11627	99.9	R3H domain cont...	Homo sapiens
XP_001154157	99.5	R3H domain (bin...	Pan troglodytes
XP_856389	95.6	similar to R3H ...	Canis lupus fam...
XP_001153781	99.5	R3H domain (bin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023219	4e-16	49.8	KIAA1002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001374	134	187	PF01424	Single-stranded nucleic acid binding R3H
HMMSmart	IPR001374	110	187	SM00393	Single-stranded nucleic acid binding R3H
ProfileScan	IPR001374	127	190	PS51061	Single-stranded nucleic acid binding R3H

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GCCACATTCCCCTCCATTTC
Primer_r	AGGGCAGGGGAACCATAAAG
PCR product length	174 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles