KIAA0020

Product ID	ORK00367
Accession No	D13645
Description	KIAA0020
Clone name	ha00602
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2112 bp) Predicted protein sequence (647 aa)
HaloTag ORF Clone	FHC00367
Flexi ORF Clone	FXC00367
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0020 by Kazusa Mouse cDNA Project

Length: 2112 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	167 bp
Genome contig ID	gi89161216r_2694178
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- CGAATCTATTTATATAAATTGTTTTTTTAAATGGT
Flanking genome sequence (99986 - 99937)	----+--------+--------+--------+--------+----* CTTTTTTAAAAATCTCAGCTGTCTCCTCTGTTACACTGAGTAGTAAGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	2794164	2828505	17	99.9	Perfect prediction

Length: 647 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_533539	0	91.6	similar to D19B...	Canis lupus fam...
BAC34427	0	89.6	unnamed protein...	Mus musculus
EDL41650	0	89.6	DNA segment, Ch...	Mus musculus
XP_215276	9.5e-215	88.4	similar to D19B...	Rattus norvegicus
XP_001066994	1e-214	88.4	similar to D19B...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43951	2.1e-08	21.1	KIAA0099

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012959	432	579	PF08144	CPL
HMMSmart	IPR001313	164	199	SM00025	Pumilio/Puf RNA-binding
	IPR001313	200	235	SM00025	Pumilio/Puf RNA-binding
	IPR001313	236	272	SM00025	Pumilio/Puf RNA-binding
	IPR001313	349	384	SM00025	Pumilio/Puf RNA-binding
	IPR001313	385	421	SM00025	Pumilio/Puf RNA-binding
	IPR001313	423	459	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	136	509	PS50303	Pumilio/Puf RNA-binding
	IPR001313	163	199	PS50302	Pumilio/Puf RNA-binding
	IPR001313	200	235	PS50302	Pumilio/Puf RNA-binding
	IPR001313	349	384	PS50302	Pumilio/Puf RNA-binding
	IPR001313	423	459	PS50302	Pumilio/Puf RNA-binding
	IPR001313	492	530	PS50302	Pumilio/Puf RNA-binding

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAAGCACCAGCAAAGGAATAG
Primer_r	TGGACCCTACCCCTTCTTTTC
PCR product length	134 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles