KIAA0112

Product ID	ORK01588
Accession No	D25218
Description	ribosome biogenesis regulator homolog
Clone name	ha00609
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1696 bp) Predicted protein sequence (399 aa)
HaloTag ORF Clone	FHC01588
Flexi ORF Clone	FXC01588
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0112 by Kazusa Mouse cDNA Project

Length: 1696 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	494 bp
Genome contig ID	gi51511724f_67403817
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAAAGATTAAGTAATAAAGATGTCTTATCTAGTG
Flanking genome sequence (101697 - 101746)	----+--------+--------+--------+--------+----* TGACTTTTAACTTTCTGACTACTGGGTAGAAATTGTACTTGAAGCCGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	67503817	67505512	1	99.0	Perfect prediction

Length: 399 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100635	8.8e-134	97.5	similar to homo...	Macaca mulatta
Q15050	4.7e-126	100.0	Ribosome biogen...	Homo sapiens
XP_001926363	7.3e-121	95.1	similar to RRS1...	Sus scrofa
XP_001494863	2.1e-119	94.5	similar to homo...	Equus caballus
XP_544107	2e-118	94.2	similar to homo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007023	56	231	PF04939	Ribosomal biogenesis regulatory protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CCAAGAGGAGGAAAATGAGCC
Primer_r	CCTCCTTTTCTCTTGCCACCC
PCR product length	166 bp
PCR conditions	95 °C15 sec64 °C120 sec32 cycles