Gene/Protein Characteristic Table for KIAA0114
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05584
Accession No D28589
Description Homo sapiens KIAA00167 mRNA, partial sequence.
Clone name ha00680
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (792 bp)
Predicted protein sequence (79 aa)
Source Myeloblast cell line (KG-1)
Features of the cloned cDNA sequence
Description

Length: 792 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 79 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX05438 1.1e-15 59.0 hCG2036618, iso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name Genebridge 4
Primer_f GCAGTGCCACAGGAGCTAGAG
Primer_r CTAACAGAATCCACCTCCGAG
PCR product length 124 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp